|
|
Vaccine Detail
|
B. pertussis DNA vaccine encoding Prn |
| Vaccine Information |
- Vaccine Name: B. pertussis DNA vaccine encoding Prn
- Target Pathogen: Bordetella pertussis
- Target Disease: Whooping Cough
- Vaccine Ontology ID: VO_0011391
- Type: DNA vaccine
- Status: Research
- Antigen: B. pertussis pertactin precursor prn2
- Prn
gene engineering:
- Type: DNA vaccine construction
- Description: To construct a prn mutant, amplification of the region containing the whole prn2 gene of the CCHMC1 strain was performed using PRN-F GGCACAGGACCGGCGCGTGTTTCGCGCACGACTCT) and PRN-R (CGCGTGGTGCGCCTGAAAGGCGGCGATGCCTTCA) with attB adaptors. The PCR products were cloned into pDONR221 to obtain pDONR-PTXA1 and pDONR-PRN2 by site-specific recombination techniques using the Gateway cloning system (Invitrogen). The regions transferred into the pDONR221 plasmid were sequenced for verification. pDONR-PTXA1 or pDONR-PRN2 was mixed with pABB-CRS2 to obtain pABB-PTXA1 and pABB-PRN2 by using the Gateway cloning system. pABB-PTXA1 or pABB-PRN2 was introduced into E. coli SM10pir and mobilized into the B. pertussis strain Tohama by conjugation (Komatsu et al., 2010).
- Detailed Gene Information: Click Here.
- DNA vaccine plasmid: pABB-CRS2 DNA vaccine plasmid
- DNA vaccine plasmid: pDONR221 DNA vaccine plasmid
- Immunization Route: Subcutaneous injection
|
| Host Response |
|
Mouse Response
- Host Strain: BALB/c
- Vaccination Protocol: 3.5-week-old female BALB/c mice (Japan SLC, Hamamatsu) were immunized by two subcutaneous injections of 0.25 SHDs (0.125 ml) over a 2-week interval (Komatsu et al., 2010).
- Challenge Protocol: Two weeks after the second immunization, 50 µl of a suspension containing approximately 6 x 10^6 CFU of B. pertussis was instilled intranasally into mice anesthetized by intraperitoneal injection with pentobarbital sodium (Nembutal; Abbott Laboratories, Abbott Park, IL). Two hours (day 0) or 2, 5, or 8 days after the challenge, the mice were euthanized by pentobarbital injection (Komatsu et al., 2010).
- Efficacy: While the vaccine was effective against all of the B. pertussis strains regardless of the allele expression pattern, the strain expressing ptxA1 and prn2 displayed a survival advantage over the other strains (Komatsu et al., 2010).
|
| References |
Komatsu et al., 2010: Komatsu E, Yamaguchi F, Abe A, Weiss AA, Watanabe M. Synergic effect of genotype changes in pertussis toxin and pertactin on adaptation to an acellular pertussis vaccine in the murine intranasal challenge model. Clinical and vaccine immunology : CVI. 2010; 17(5); 807-812. [PubMed: 20357056].
|
|