|
|
Vaccine Detail
|
AdRTVP-1-Transduced Prostate Cancer Cell-Based Vaccine |
| Vaccine Information |
- Vaccine Name: AdRTVP-1-Transduced Prostate Cancer Cell-Based Vaccine
- Target Pathogen: Cancer
- Target Disease: Cancer
- Vaccine Ontology ID: VO_0007211
- Type: Recombinant vector vaccine
- Status: Clinical trial
- Host Species for Licensed Use: Human
- Host Species as Laboratory Animal Model: Human
- Antigen: GLIPR1
- GLIPR1
gene engineering:
- Type: Recombinant protein preparation
- Description:
- Detailed Gene Information: Click Here.
- Preparation: GLIPR1-ΔTM coding sequence was obtained from normal prostate tissue by RT-PCR using specific primers (forward: 5′CCCAAGCTTGCAAATATTTTGCCAGAT3′, reverse: 5′ATAGTTTAGCGGCCGCTCTGTTACGTGGATATAT3′). The PCR product was digested with HinIII and NotI and inserted into pSectag/Hygro2 HinIII and NotI sites to generate pSec-GLIPR1-ΔTM. Conditioned medium from 293 Freestyle cells transfected with pSec–GLIPR1-ΔTM was collected and centrifuged, and GLIPR1-ΔTM was purified using Ni-NTA agarose (Li et al., 2013).
- Description: A cell-based vaccine comprised of prostate cancer cells transduced with an adenoviral vector encoding human RTVP-1 (AdRTVP-1), with potential antineoplastic and immunostimulating activities. RTVP-1, also referred to as glioma pathogenesis-related protein 1 (GLIP1), is down-regulated in prostate tumors. Regulated by tumor suppressor p53, the expression of RTVP-1 functions as a tumor suppressor, and is abundant in normal human prostate epithelial cells as well as in differentiated macrophages. Administration of this vaccine leads to an induction of apoptosis through the expression of RTVP-1 and results in a reduction in cellular proliferation in prostate cancer cells. In addition, this cancer-cell based vaccine may induce a cytotoxic T lymphocyte (CTL) response against prostate specific tumor associated antigens, resulting in an immune-mediated prostate cancer cell death. Furthermore, RTVP-1 stimulates CTL and natural killer (NK) cell activities. (NCIT_C64785).
|
| Host Response |
|
|
| References |
Li et al., 2013: Li L, Yang G, Ren C, Tanimoto R, Hirayama T, Wang J, Hawke D, Kim SM, Lee JS, Goltsov AA, Park S, Ittmann MM, Troncoso P, Thompson TC. Glioma pathogenesis-related protein 1 induces prostate cancer cell death through Hsc70-mediated suppression of AURKA and TPX2. Molecular oncology. 2013; 7(3); 484-496. [PubMed: 23333597].
NCIT_C64785: [https://ncit.nci.nih.gov/ncitbrowser/ConceptReport.jsp?dictionary=NCI_Thesaurus&code=C64785]
|
|