VIOLIN Logo
VO Banner
Search: for Help
About
Introduction
Statistics
VIOLIN News
Your VIOLIN
Register or Login
Submission
Tutorial
Vaccine & Components
Vaxquery
Vaxgen
VBLAST
Protegen
VirmugenDB
DNAVaxDB
CanVaxKB
Vaxjo
Vaxvec
Vevax
Huvax
Cov19VaxKB
VaxCT
Host Responses
VaximmutorDB
VIGET
Vaxafe
Vaxar
Vaxism
Vaccine Literature
VO-SciMiner
Litesearch
Vaxmesh
Vaxlert
Vaccine Design
Vaxign2
Vaxign
Community Efforts
Vaccine Ontology
ICoVax 2012
ICoVax 2013
Advisory Committee
Vaccine Society
Vaxperts
VaxPub
VaxCom
VaxLaw
VaxMedia
VaxMeet
VaxFund
VaxCareer
Data Exchange
V-Utilities
VIOLINML
Help & Documents
Publications
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UM Logo

Vaccine Detail

Brucella recombinant SurA protein vaccine
Vaccine Information
  • Vaccine Name: Brucella recombinant SurA protein vaccine
  • Target Pathogen: Brucella spp.
  • Target Disease: Brucellosis
  • Vaccine Ontology ID: VO_0000358
  • Type: Subunit vaccine
  • Status: Research
  • Antigen: The antigen for this vaccine is SurA protein from B. abortus strain 2308, B. abortus strain S19, and Brucella melitensis strain H38 (Delpino et al., 2007).
  • SurA gene engineering:
    • Type: Recombinant protein preparation
    • Description: Mice given rSurA with adjuvant exhibited a significant degree of protection against B. abortus infection (Delpino et al., 2007b).
    • Detailed Gene Information: Click Here.
  • Adjuvant: complete Freund's adjuvant
    • Adjuvant name: complete Freund's adjuvant
    • VO adjuvant ID: VO_0000139
    • Description: Two different adjuvants were used in these vaccines: Complete Freund's Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA). CFA was administered on day 0 and IFA was administered on day 15 (Delpino et al., 2007).
  • Adjuvant: incomplete Freund's adjuvant
    • Adjuvant name: incomplete Freund's adjuvant
    • VO adjuvant ID: VO_0000142
    • Description: Two different adjuvants were used in these vaccines: Complete Freund's Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA). CFA was administered on day 0 and IFA was administered on day 15 (Delpino et al., 2007).
  • Preparation: The PCR primers for cloning SurA gene from B. abortus were as follows: sense 5′AGAAAGCATATGTTTGCAAGACCTCTT3′ (NdeI) and antisense 5′TCTTCGGGATCCTCAACGATTGACGATGGT3′ (BamHI). B. abortus genomic DNA was used as template for PCR with Pfu DNA polymerase (Stratagene). The surA gene was cloned to plasmid Pet17b and then transformed to E. coli JM19 and then BL21(DE3) competent cells. Recombinant proteins were adsorbed with Sepharose-polymyxin B (Sigma, St. Louis, MO) to eliminate lipopolysaccharide contamination. The antigen and PBS were administered mixed with Complete Freund's Adjuvant (CFA) (Sigma) on day 0 and with Incomplete Freund's Adjuvant (IFA) on day 15 (Delpino et al., 2007).
  • Immunization Route: Nasal spray, Intraperitoneal injection (i.p.)
Host Response

Mouse Response

  • Host Strain: Balb/c
  • Vaccination Protocol: Female BALB/c mice of 6 to 8-weeks old were used for the testing of these vaccines. Mice were anaesthetized with methoxyfuorane and immunized by the intraperitoneal route with (i) 30 μg of rSurA, (ii) 30 μg of rDnaK, (iii) rSurA + rDnaK (30 μg + 30 μg) or iv) PBS, which was the negative control. Antigens and PBS were administered mixed with Complete Freund's Adjuvant (CFA) on day 0 and with Incomplete Freund's Adjuvant (IFA) on day 15. A fifth group of mice was immunized i.p with 30 μg rDnaK in PBS without no adjuvant on days 0 and 15. As reference vaccinated controls other groups were immunized once (i) by the subcutaneous route at day 0 with 8 × 10^8 formalin-killed B. melitensis H38S in IFA or (ii) i.p with 1 × 10^4 live B. abortus S19. Two separate assays of immunization were performed. The first experiment included groups immunized with rDnaK plus adjuvant, rDnaK without adjuvant, rSurA, and the negative (PBS) and reference (H38) control groups. The second experiment included groups immunized with rDnaK, rSurA, and rDnaK + rSurA, all with adjuvant, and the negative (PBS) and reference (B. abortus S19) control groups. Sera for antibody detection were obtained by retro-orbital bleeding under anaesthesia at 15, 30, 45 and 75 days after the first immunization (Delpino et al., 2007).
  • Immune Response: Immunization with rSurA elicited a vigorous IgG response that was detectable after the first immunization, increased further after the second Ag injection. PBS-immunized animals challenged with B. abortus 2308 developed antibodies against rSurA at 1 month after infection. Anti-rSurA IgG2a titers were higher than IgG1 titers during the whole immunization. rSurA stimulated significant production of IFN-γ, IL-2, IL-4 and IL-5 in spleen cells from rSurA-immunized animals but not from the PBS control group. All animals immunized with rDnaK alone elicited a humoral immune response that was detectable 15 days after the first immunization and increased further after the second injection to reach an IgG mean titer of 217,000 at day 30 post-vaccination. Immunization with rDnaK plus adjuvant induced similar anti-rDnaK IgG titers than immunization with rDnaK alone. None of the animals inoculated with PBS showed specific anti-rDnaK Abs at the time of challenge but notably, 30 days after infection all of them produced anti-rDnaK. Stimulation with rDnaK induced a significant production of IFN-γ and IL-2 in spleen cells from all mice immunized with rDnaK plus adjuvant Cells from rDnaK alone- or PBS-immunized mice were unable to stimulate the secretion of IFN-γ, IL-2, IL-4, IL-5 or IL-10 in response to rDnaK (Delpino et al., 2007).
  • Challenge Protocol: Immunized mice were challenged by i.p. injection with 1 × 10^4 B. abortus 2308 (Delpino et al., 2007).
  • Efficacy: Mice given rSurA or rDnaK plus adjuvant exhibited a significant degree of protection against B. abortus when compared with controls receiving PBS. Formalin-killed B. melitensis H38S, the control vaccine, induced 2.19 units of protection against B. abortus. Immunization with rDnaK alone induced a low but still significant level of protection. In a second experiment, both evaluated vaccines (rDnaK or rSurA plus adjuvant) induced significant protection against B. abortus infection. There was no additive protection by the simultaneous immunization with both rDnaK and rSurA. All evaluated vaccines induced less protection than H38 or B. abortus strain 19 control vaccines. Altogether these results indicate that rSurA or rDnaK in adjuvant induce partial protection against B. abortus infection (Delpino et al., 2007).
  • Host Ifng (Interferon gamma) response
    • Description: Spleen cells from mice were used to determine cytokine levels 1 month after last immunization. Mice immunized with rSurA and stimulated with SurA had significantly higher levels of IFN-gamma than did mice immunized with PBS and stimulated with SurA (Delpino et al., 2007b).
    • Detailed Gene Information: Click Here.
  • Host Il2 response
    • Description: Spleen cells from mice were used to determine cytokine levels 1 month after last immunization. Mice immunized with rSurA and stimulated with SurA had significantly higher levels of IL-2 than did mice immunized with PBS and stimulated with SurA (Delpino et al., 2007b).
    • Detailed Gene Information: Click Here.
  • Host Il4 (interleukin 4) response
    • Description: Spleen cells from mice were used to determine cytokine levels 1 month after last immunization. Mice immunized with rSurA and stimulated with SurA had significantly higher levels of IL-4 than did mice immunized with PBS and stimulated with SurA (Delpino et al., 2007b).
    • Detailed Gene Information: Click Here.
  • Host Il5 response
    • Description: Spleen cells from mice were used to determine cytokine levels 1 month after last immunization. Mice immunized with rSurA and stimulated with SurA had significantly higher levels of IL-5 than did mice immunized with PBS and stimulated with SurA (Delpino et al., 2007b).
    • Detailed Gene Information: Click Here.
References
Delpino et al., 2007b: Delpino MV, Estein SM, Fossati CA, Baldi PC, Cassataro J. Vaccination with Brucella recombinant DnaK and SurA proteins induces protection against Brucella abortus infection in BALB/c mice. Vaccine. 2007; 25(37-38); 6721-6729. [PubMed: 17686554].