Bordetella pertussis is a Gram-negative, aerobic coccobacillus of the genus Bordetella, and the causative agent of pertussis or whooping cough. Pertussis (or Whooping Cough), is an infection of the respiratory system and characterized by a “whooping” sound when the person breathes in. In the US it killed 5,000 to 10,000 people per year before a vaccine was available. Vaccination has transformed this and between 1985-88 fewer than 100 children died from pertussis. Worldwide in 2000, according to the WHO, around 39 million people were infected annually and about 297,000 died. Bordetella pertussis infects its host by colonizing lung epithelial cells. The infection occurs most with children under the age of one when they are unimmunized or children with faded immunity, normally around the age 11 through 18. The signs and symptoms are similar to a common cold: runny nose, sneezing, mild cough, and low-grade fever. The patient becomes most contagious during the catarrhal stage of infection, normally 2 weeks after the coughing begins. It may become airborne when the person coughs, sneezes, or laughs. Pertussis vaccine is part of the DTaP (diphtheria, tetanus, acellular pertussis) immunization. The paroxysmal cough precedes a crowing inspiratory sound characteristic of pertussis. After a spell, the patient might make a “whooping” sound when breathing in, or vomit. Adults have milder symptoms, like prolonged coughing without the “whoop.” Infants less than 6 months may not have the typical whoop. A coughing spell may last a minute or more, producing cyanosis, apnoea and seizures. However, when not in a coughing fit, the patient does not experience trouble breathing. This is because Bordetella pertussis inhibits the immune response and therefore very little mucus is generated in the lungs. A prolonged cough may be irritating and sometimes a disabling cough may go undiagnosed in adults for many months (Wiki: Bordetella pertussis).
4. Microbial Pathogenesis
The bacterium contains a surface protein, filamentous hemagglutinin, which binds to sulfatides that are found on cilia of epithelial cells. Once anchored, the bacterium produces tracheal cytotoxin, which stops the cilia from beating. This prevents the cilia from clearing debris from the lungs, so the body responds by sending the host into a coughing fit. These coughs expel some bacteria into the air, which are free to infect other hosts. Bordetella pertussis has the ability to inhibit the function of the host's immune system. Two toxins, known as the pertussis toxin (or PTx) and adenylate cyclase (CyaA), are responsible for this inhibition. CyaA converts ATP to cyclic AMP, and PTx inhibits an intracellular protein that regulates this process. The end result is that phagocytes convert too much ATP to cyclic AMP, which can cause disturbances in cellular signaling mechanisms, and prevent phagocytes from correctly responding to an infection (Wiki: Bordetella pertussis).
5. Host Ranges and Animal Models
Animal models of pertussis include primates, rats, mice, and rabbits (Salyers and Whitt., 2002).
6. Host Protective Immunity
Acellular pertussis vaccines are effective in providing immunity to whooping cough, by stimulating antibodies to pertussis toxins, as well as an adhesin (Salyers and Whitt., 2002).
Molecule Role Annotation :
An aroA mutant is highly attenuated in mice and induces significant protection from challenge with wild type B. pertussis (Roberts et al., 1990).
Molecule Role Annotation :
A soluble fraction obtained from Bordetella pertussis was evaluated as adjuvant for the pertussis component of the Diphtheria-Pertussis-Tetanus (DPT) vaccine. High levels of antibodies were induced, and a 78% protection rate of mice challenged with live B. pertussis was observed. Two proteins were identified as the 73 kDa N-terminal alpha-domain of BrkA autotransporter protein and the Cpn60/60 kDa chaperonin. Both stimulated antibodies against pertussis and induced a 42% protection rate against the challenge (Cainelli et al., 2007).
Molecule Role Annotation :
A soluble fraction obtained from Bordetella pertussis was evaluated as adjuvant for the pertussis component of the Diphtheria-Pertussis-Tetanus (DPT) vaccine. High levels of antibodies were induced, and a 78% protection rate of mice challenged with live B. pertussis was observed. Two proteins were identified as the 73 kDa N-terminal alpha-domain of BrkA autotransporter protein and the Cpn60/60 kDa chaperonin. Both stimulated antibodies against pertussis and induced a 42% protection rate against the challenge (Cainelli et al., 2007).
Molecule Role Annotation :
A study demonstrated that passive immunization with specific anti-B. pertussis adenylate cyclase antibodies or active immunization with purified B. pertussis secreted adenylate cyclase (cyaA) protect mice against a lethal respiratory challenge with B. pertussis or B. parapertussis. Results suggest that adenylate cyclase might be the primary cytotoxin responsible for mouse pulmonary lesions during respiratory tract infection with B. pertussis or with the related species B. parapertussis and is a protective antigen of B. pertussis (Guiso et al., 1989).
Protein Note :
Previously sequenced as Bordetella pertussis dermonecrotic toxin Dnt TR:Q45336 (EMBL: U10527) (1451 aa) fasta scores: E(): 0, 100% id in 1451 aa. Almost identical to Bordetella bronchiseptica dermonecrotizing toxin TR:Q9S5D5 (EMBL: AB020025) (1464 aa) fasta scores: E(): 0, 98.97% id in 1464 aa
Molecule Role Annotation :
A live attenuated B. pertussis vaccine strain BPZE1 that protects mice upon a single intranasal administration was developed by deleting dnt gene (Feunou et al., 2008).
Molecule Role Annotation :
A combination of the 69-kDa outer membrane protein and filamentous hemagglutinin (fhaB), both isolated from lymphocytosis promoting factor (LPF; pertussis toxin) minus mutants of Bordetella pertussis, is protective in the mouse intracerebral challenge potency (Kendrick) test (Novotny et al., 1991).
Protein Note :
Identical to the previously sequenced Bordetella pertussis pertactin precursor Prn or Omp69A SW:PERT_BORPE (P14283) (910 aa) fasta scores: E(): 0, 100% id in 910 aa, and to Bordetella bronchiseptica pertactin precursor Prn SW:PERT_BORBR (Q03035) (911 aa) fasta scores: E(): 1.4e-160, 91.31% id in 921 aa
Molecule Role Annotation :
Researchers constructed isogenic mutants of B. pertussis Tohama expressing the alleles ptxA1 or ptxA2 and prn1 or prn2 and compared the efficacies of an acellular pertussis vaccine against the mutants in a mouse model. While the vaccine was effective against all of the B. pertussis strains regardless of the allele expression pattern, the strain expressing ptxA1 and prn2 displayed a survival advantage over the other strains (Komatsu et al., 2010).
Protein Note :
Previously sequenced as Bordetella pertussis pertussis toxin subunit 1 precursor, NAD-dependent ADP-ribosyltransferase, PtxA SW:TOX1_BORPE (P04977) (269 aa) fasta scores: E(): 1.5e-110, 100% id in 269 aa
Molecule Role Annotation :
BALB/c mice were immunized with PTx vaccine on day 6 of life and then challenged with B. pertussis using the aerosol challenge model. These primed mice were significantly better protected against leukocytosis, weight loss, and proliferation of B. pertussis in the lungs following aerosol challenge than the nonprimed group. This protection correlated with levels of anti-PT antibody in serum present on the day of aerosol challenge (Bruss and Siber, 2002).
Molecule Role Annotation :
BALB/c mice were immunized with PTx vaccine on day 6 of life and then challenged with B. pertussis using the aerosol challenge model. These primed mice were significantly better protected against leukocytosis, weight loss, and proliferation of B. pertussis in the lungs following aerosol challenge than the nonprimed group. This protection correlated with levels of anti-PT antibody in serum present on the day of aerosol challenge (Bruss and Siber, 2002).
Molecule Role Annotation :
BALB/c mice were immunized with PTx vaccine on day 6 of life and then challenged with B. pertussis using the aerosol challenge model. These primed mice were significantly better protected against leukocytosis, weight loss, and proliferation of B. pertussis in the lungs following aerosol challenge than the nonprimed group. This protection correlated with levels of anti-PT antibody in serum present on the day of aerosol challenge (Bruss and Siber, 2002).
Molecule Role Annotation :
BALB/c mice were immunized with PTx vaccine on day 6 of life and then challenged with B. pertussis using the aerosol challenge model. These primed mice were significantly better protected against leukocytosis, weight loss, and proliferation of B. pertussis in the lungs following aerosol challenge than the nonprimed group. This protection correlated with levels of anti-PT antibody in serum present on the day of aerosol challenge (Bruss and Siber, 2002).
Molecule Role Annotation :
BALB/c mice were immunized with PTx vaccine on day 6 of life and then challenged with B. pertussis using the aerosol challenge model. These primed mice were significantly better protected against leukocytosis, weight loss, and proliferation of B. pertussis in the lungs following aerosol challenge than the nonprimed group. This protection correlated with levels of anti-PT antibody in serum present on the day of aerosol challenge (Bruss and Siber, 2002).
Molecule Role Annotation :
Intranasal administration of IEM101 expressing Tcf induced a significant reduction in bacterial colonization of the tracheas of mice challenged with wild-type B. pertussis. These data are in agreement with the putative role of Tcf in Bordetella tracheal colonization (Chen et al., 1998).
Clostridium tetani is grown in modified Mueller-Miller casamino acid medium without beef heart infusion. Tetanus toxin is detoxified with formaldehyde and purified by ammonium sulfate fractionation and diafiltration. Diphtheria and tetanus toxoids are individually adsorbed onto aluminum phosphate (FDA: Adacel).
m. Immunization Route
Intramuscular injection (i.m.)
n. Storage
Adacel vaccine should be stored at 2° to 8°C (35° to 46°F). DO NOT FREEZE
o . Approved Age for Licensed Use
Adacel vaccine is indicated for active booster immunization for the prevention of tetanus, diphtheria and pertussis as a single dose in persons 11 through 64 years of age.
p. Contraindication
A severe allergic reaction (e.g., anaphylaxis) after a previous dose of Adacel vaccine or any other tetanus toxoid, diphtheria toxoid or pertussis containing vaccine or any other component of this vaccine is a contraindication to vaccination with Adacel vaccine (FDA: Adacel).
q. Description
It is a sterile liquid suspension of tetanus and diphtheria toxoids and acellular pertussis components adsorbed onto aluminum phosphate, for intramuscular administration.
3. Adacel-Polio
a. Product Name:
Tetanus Toxoid, Reduced Diphtheria Toxoid and Acellular Pertussis Vaccine Adsorbed Combined with Inactivated Poliomyelitis Vaccine
b. Tradename:
Adacel-Polio
c. Manufacturer:
Sanofi Pasteur SA
d. Type:
Toxoid vaccine + Subunit vaccine + Inactivated or "killed" vaccine
e. Status:
Licensed
f. Location Licensed:
Canada
g. Host Species for Licensed Use:
Human
h. Preservative:
2-phenoxyethanol
i. Allergen:
Neomycin, Polymyxin B, Streptomycin
j. Immunization Route
Intramuscular injection (i.m.)
k. Storage
Store at 2° to 8°C (35° to 46°F), do not freeze.
l . Approved Age for Licensed Use
4 years and older.
m. Description
ADACEL®-POLIO is a sterile, uniform, cloudy, white suspension of tetanus and diphtheria toxoids and acellular pertussis vaccine adsorbed separately on aluminum phosphate and combined with inactivated poliomyelitis vaccine (vero cell origin) types 1, 2 and 3, and suspended in water for injection. Acellular pertussis vaccine is composed of five purified pertussis antigens (PT, FHA, PRN and FIM). (Product Monograph: Adacel-Polio)
Description:
Fraction BS was applied to a Mono Q Sepharose (Amersham, Biosciences) (0.5 mg protein per ml resin) previously equilibrated with 25 mM Tris–HCl, pH 8.0. Proteins were eluted with a NaCl gradient (0–1 M) in 25 mM Tris–HCl, pH 8.0, in 0.5 ml fractions at a flow rate of 1 ml/min. Elution was monitored at A280 nm. The fractions showing the same peak profile were pooled and eluted again under the same chromatography conditions. Samples were submitted to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (T = 12.5% in 0.75 M Tris, 0.2% SDS, pH 8.8) and electrophoresis was performed at 60 mA in 25 mM Tris, 0.192 M glycine, 0.1% SDS, pH 8.3. The gel was stained with silver nitrate and fractions showing a similar molecular mass profile were pooled, concentrated by centrifugation at 440 × g in Centrifugal Ultrafree-20 tubes, 10 kDa (Millipore), and their protein concentration was evaluated. Four pools were formed (P1, P2, P3, P4), and used for immunization of mice (Cainelli et al., 2007).
Vaccination Protocol:
Female BALB/c mice, 4–6 weeks old (Animal House of the Instituto Butantan) (9–15 mice/group) were subcutaneously injected three times at weekly intervals (days 0, 7, 14) with BS pools (P1, P2, P3, P4) (1 μg/0.1 ml/mouse), and two times (days 0 and 14) with 73 kDa or 60 kDa proteins (1 μg/0.1 ml/mouse) alone or mixed with Diphtheria-Pertussis-Tetanus (DPT) vaccine formulated without aluminum hydroxide (NA-DPT), (2 μl/mouse), (Instituto Butantan). Current DPT vaccine containing aluminum hydroxide (DPTBut) was used as control (2 μl/mouse) (Lot no. 0008147/0 and 0309132, Instituto Butantan). Non-immunized mice (injected with physiologic saline) were used as control (Cainelli et al., 2007).
Challenge Protocol:
Animals were challenged by intracerebral route (i.c.) with live B. pertussis (strain 18323, NIH, USA), 21 days after the first immunization. Each mouse was inoculated with 30,000 live bacteria. Deaths were recorded until day 15 (Cainelli et al., 2007).
Efficacy:
High levels of antibodies were induced, and a 78% protection rate of mice challenged with live B. pertussis was observed. The 73 kDa N-terminal alpha-domain of BrkA autotransporter protein, one protein identified in the fraction, stimulated antibodies against pertussis and induced a 42% protection rate against the challenge (Cainelli et al., 2007).
Description:
Fraction BS was applied to a Mono Q Sepharose (Amersham, Biosciences) (0.5 mg protein per ml resin) previously equilibrated with 25 mM Tris–HCl, pH 8.0. Proteins were eluted with a NaCl gradient (0–1 M) in 25 mM Tris–HCl, pH 8.0, in 0.5 ml fractions at a flow rate of 1 ml/min. Elution was monitored at A280 nm. The fractions showing the same peak profile were pooled and eluted again under the same chromatography conditions. Samples were submitted to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (T = 12.5% in 0.75 M Tris, 0.2% SDS, pH 8.8) and electrophoresis was performed at 60 mA in 25 mM Tris, 0.192 M glycine, 0.1% SDS, pH 8.3. The gel was stained with silver nitrate and fractions showing a similar molecular mass profile were pooled, concentrated by centrifugation at 440 × g in Centrifugal Ultrafree-20 tubes, 10 kDa (Millipore), and their protein concentration was evaluated. Four pools were formed (P1, P2, P3, P4), and used for immunization of mice (Cainelli et al., 2007).
Vaccination Protocol:
Female BALB/c mice, 4–6 weeks old (Animal House of the Instituto Butantan) (9–15 mice/group) were subcutaneously injected three times at weekly intervals (days 0, 7, 14) with BS pools (P1, P2, P3, P4) (1 μg/0.1 ml/mouse), and two times (days 0 and 14) with 73 kDa or 60 kDa proteins (1 μg/0.1 ml/mouse) alone or mixed with Diphtheria-Pertussis-Tetanus (DPT) vaccine formulated without aluminum hydroxide (NA-DPT), (2 μl/mouse), (Instituto Butantan). Current DPT vaccine containing aluminum hydroxide (DPTBut) was used as control (2 μl/mouse) (Lot no. 0008147/0 and 0309132, Instituto Butantan). Non-immunized mice (injected with physiologic saline) were used as control (Cainelli et al., 2007).
Challenge Protocol:
Animals were challenged by intracerebral route (i.c.) with live B. pertussis (strain 18323, NIH, USA), 21 days after the first immunization. Each mouse was inoculated with 30,000 live bacteria. Deaths were recorded until day 15 (Cainelli et al., 2007).
Efficacy:
High levels of antibodies were induced, and a 78% protection rate of mice challenged with live B. pertussis was observed. The Cpn60/60 kDa chaperonin, one protein identified in the fraction, stimulated antibodies against pertussis and induced a 42% protection rate against the challenge (Cainelli et al., 2007).
Description:
The AC was purified from culture supernatants using a camodulin affinity chromatography. The preparation consisted of two polypeptides of 45 and 43 kDa that are structurally related as described by Ladant et al (Guiso et al., 1989).
Vaccination Protocol:
For active immunizations, Balb/c mice were given, subcutaneously, 3,ug of purified AC adsorbed on aluminium hydroxide, three times, at one week intervals . The mice were bled 5 days after the last injection in order to assess the presence of circulating anti-AC antibodies . The lethal challenge was performed 9 days after the final injection (Guiso et al., 1989).
Challenge Protocol:
Bacterial suspension (50 pl) was injected intranasally to groups of 10 3-week-old female Balb/c mice (CERJ, St Berthevin, France), weighing 16±1 g . The LD 50 for the challenge inocula was determined daily by recording the number of dead mice . Pulmonary edema was quantified by lung weight (Guiso et al., 1989).
Efficacy:
Active immunization with purified B. pertussis secreted adenylate cyclase (cyaA) protect mice against a lethal respiratory challenge with B. pertussis or B. parapertussis (Guiso et al., 1989).
Description:
To construct a prn mutant, amplification of the region containing the whole prn2 gene of the CCHMC1 strain was performed using PRN-F GGCACAGGACCGGCGCGTGTTTCGCGCACGACTCT) and PRN-R (CGCGTGGTGCGCCTGAAAGGCGGCGATGCCTTCA) with attB adaptors. The PCR products were cloned into pDONR221 to obtain pDONR-PTXA1 and pDONR-PRN2 by site-specific recombination techniques using the Gateway cloning system (Invitrogen). The regions transferred into the pDONR221 plasmid were sequenced for verification. pDONR-PTXA1 or pDONR-PRN2 was mixed with pABB-CRS2 to obtain pABB-PTXA1 and pABB-PRN2 by using the Gateway cloning system. pABB-PTXA1 or pABB-PRN2 was introduced into E. coli SM10pir and mobilized into the B. pertussis strain Tohama by conjugation (Komatsu et al., 2010).
Vaccination Protocol:
3.5-week-old female BALB/c mice (Japan SLC, Hamamatsu) were immunized by two subcutaneous injections of 0.25 SHDs (0.125 ml) over a 2-week interval (Komatsu et al., 2010).
Challenge Protocol:
Two weeks after the second immunization, 50 µl of a suspension containing approximately 6 x 10^6 CFU of B. pertussis was instilled intranasally into mice anesthetized by intraperitoneal injection with pentobarbital sodium (Nembutal; Abbott Laboratories, Abbott Park, IL). Two hours (day 0) or 2, 5, or 8 days after the challenge, the mice were euthanized by pentobarbital injection (Komatsu et al., 2010).
Efficacy:
While the vaccine was effective against all of the B. pertussis strains regardless of the allele expression pattern, the strain expressing ptxA1 and prn2 displayed a survival advantage over the other strains (Komatsu et al., 2010).
Vaccination Protocol:
For immunization, 0.5 mg of gold particles were coated with 2 μg of plasmid DNA and 0.5 mg gold per injection was used. Mice were immunized intradermally three times on days 0, 14, and 28 using a Helios Gene Gun at a helium gas pressure of 400 psi (Kamachi et al., 2003).
Immune Response:
Gene gun vaccination was employed for the delivery of pcDNA/S1, and the induction of IgG1 predominant antibody production was observed (Kamachi et al., 2003).
Challenge Protocol:
Immunized BALB/c mice were challenged intranasally with B. pertussis strain 18–323 (Kamachi et al., 2003).
Efficacy:
In the pcDNA/S1-immune group, five out of 10 mice survived 24 hours after the challenge, whereas all of the mice in the pcDNA-immune group died within 24 hours (Kamachi et al., 2003).
9. B. pertussis FhaB and 69 kDa OMP protein vaccine
Combination of the B. pertussis 69-kDa outer membrane protein and filamentous hemagglutinin (fhaB)
e. Gene Engineering of
fhaB
Type:
Recombinant protein preparation
Description:
A crystal clear supernatant of 5-day-old static cultures containing proteolysis inhibitor was purified. To remove impurities, the FHA was precipitated by overnight dialysis against 25-30 volumes of buffer A at 4 C, and the precipitate was collected by centrifugation. The precipitated FHA was dissolved in the smallest possible volume of 40 mM B-alanine buffer at pH 3.5, clarified by centrifugation, and applied at room temperature at a flow of 30 ml/h to a Superose 12 column. The retained highly purified FHA was eluted (Novotny et al., 1991).
Vaccination Protocol:
Groups of mice were injected intraperitoneally with 0.5 ml volumes of four concentrations (Novotny et al., 1991).
Challenge Protocol:
Mice were challenged intracerebrally 14 days after antigen injection. The challenge dose contained 300-400 LD50, and a 1:1250 dilution of the challenge does contained ~ 10cfu. All mice were challenged within 90 minutes after the challenge suspension was thawed; the challenge was injected using a 1 ml syringe in a Hamilton PB600-I dispensor that reproducibly delivers 20-ul voumes (Novotny et al., 1991).
Efficacy:
A combination of the 69-kDa outer membrane protein and filamentous hemagglutinin (fhaB), both isolated from lymphocytosis promoting factor (LPF; pertussis toxin) minus mutants of Bordetella pertussis, is protective in the mouse intracerebral challenge potency (Kendrick) test (Novotny et al., 1991).
Description:
Vaccine is prepared by chemically modifying purified PT from culture supernatants with tetranitromethane (TNM). The lot was adsorbed to aluminum hydroxide (Alhydogel; Superfos, Vedbaek, Denmark) at a concentration of 50 μg of protein adsorbed to 4 mg per 1.0 ml. Animal doses (2.5, 0.5, and 0.1 μg) were prepared by making fivefold serial dilutions in aluminum hydroxide (4 mg/ml) diluent and given in a volume of 50 μl (Bruss and Siber, 2002).
Description:
Vaccine is prepared by chemically modifying purified PT from culture supernatants with tetranitromethane (TNM). The lot was adsorbed to aluminum hydroxide (Alhydogel; Superfos, Vedbaek, Denmark) at a concentration of 50 μg of protein adsorbed to 4 mg per 1.0 ml. Animal doses (2.5, 0.5, and 0.1 μg) were prepared by making fivefold serial dilutions in aluminum hydroxide (4 mg/ml) diluent and given in a volume of 50 μl (Bruss and Siber, 2002).
Description:
Vaccine is prepared by chemically modifying purified PT from culture supernatants with tetranitromethane (TNM). The lot was adsorbed to aluminum hydroxide (Alhydogel; Superfos, Vedbaek, Denmark) at a concentration of 50 μg of protein adsorbed to 4 mg per 1.0 ml. Animal doses (2.5, 0.5, and 0.1 μg) were prepared by making fivefold serial dilutions in aluminum hydroxide (4 mg/ml) diluent and given in a volume of 50 μl (Bruss and Siber, 2002).
Description:
Vaccine is prepared by chemically modifying purified PT from culture supernatants with tetranitromethane (TNM). The lot was adsorbed to aluminum hydroxide (Alhydogel; Superfos, Vedbaek, Denmark) at a concentration of 50 μg of protein adsorbed to 4 mg per 1.0 ml. Animal doses (2.5, 0.5, and 0.1 μg) were prepared by making fivefold serial dilutions in aluminum hydroxide (4 mg/ml) diluent and given in a volume of 50 μl (Bruss and Siber, 2002).
Description:
Vaccine is prepared by chemically modifying purified PT from culture supernatants with tetranitromethane (TNM). The lot was adsorbed to aluminum hydroxide (Alhydogel; Superfos, Vedbaek, Denmark) at a concentration of 50 μg of protein adsorbed to 4 mg per 1.0 ml. Animal doses (2.5, 0.5, and 0.1 μg) were prepared by making fivefold serial dilutions in aluminum hydroxide (4 mg/ml) diluent and given in a volume of 50 μl (Bruss and Siber, 2002).
Vaccination Protocol:
Mice were removed from their cages, weighed, and placed on a stainless steel rack that fits inside of the Plexiglas aerosol chamber (40 by 40 by 40 cm). The 21-h culture of B. pertussis was suspended in sterile PBS to a concentration of approximately 2 × 10^9 CFU/ml of inoculum. This inoculum was delivered to the mice using a standard nebulizer (model 647; Devilbis, Somerset, Pa.) with a set pressure of 1.5 kg/cm2. The chamber and the nebulizer were enclosed in a biosafety level-2 hood and certified prior to use to document that airflow barriers were maintained. Uniformity of aerosol in the chamber was maintained with the use of two PABST 900 series AC fans (Newark Supply, Newark, N.J.). The even dispersion of the aerosol was confirmed with a light laser (Bruss and Siber, 2002).
Challenge Protocol:
Mice were exposed to nebulization for 30 min and removed 30 min after termination of aerosol. The completion of the aerosol represented time 0. Mice were removed from the box and replaced into their cages. Cages were checked daily for mortality (Bruss and Siber, 2002).
Efficacy:
BALB/c mice were immunized with PTx vaccine on day 6 of life and then challenged with B. pertussis using the aerosol challenge model. These primed mice were significantly better protected against leukocytosis, weight loss, and proliferation of B. pertussis in the lungs following aerosol challenge than the nonprimed group. This protection correlated with levels of anti-PT antibody in serum present on the day of aerosol challenge (Bruss and Siber, 2002).
11. Boostrix
a. Product Name:
Tetanus Toxoid, Reduced Diphtheria Toxoid and Acellular Pertussis Vaccine, Adsorbed
Tetanus toxin is produced by growing Clostridium tetani in a modified Latham medium derived from bovine casein. Toxins are detoxified with formaldehyde, concentrated by ultrafiltration, and purified by precipitation, dialysis, and sterile filtration (FDA: Boostrix).
l. Immunization Route
Intramuscular injection (i.m.)
m. Storage
Store refrigerated between 2º and 8ºC (36º and 46ºF). Do not freeze.
n . Approved Age for Licensed Use
BOOSTRIX is approved for use in individuals 10 through 64 years of age
o. Contraindication
A severe allergic reaction after a previous dose of any tetanus toxoid-diphtheria toxoid or pertussis antigen containing vaccine or any component of this vaccine is a contraindication to administration of BOOSTRIX (FDA: Boostrix).
p. Description
BOOSTRIX (Tetanus Toxoid, Reduced Diphtheria Toxoid and Acellular Pertussis Vaccine, Adsorbed) is a noninfectious, sterile, vaccine for intramuscular administration. It contains tetanus toxoid, diphtheria toxoid, and pertussis antigens (inactivated pertussis toxin [PT] and formaldehyde-treated filamentous hemagglutinin [FHA] and pertactin). The antigens are the same as those in INFANRIX, but BOOSTRIX is formulated with reduced quantities of these antigens (FDA: Boostrix).
12. Boostrix-Polio
a. Product Name:
Combined diphtheria, tetanus, acellular pertussis (adsorbed) and inactivated poliomyelitis vaccine
b. Tradename:
Boostrix-Polio
c. Manufacturer:
GlaxoSmithKline
d. Type:
Toxoid vaccine + Subunit vaccine + Inactivated or "killed" vaccine
e. Status:
Licensed
f. Location Licensed:
Canada
g. Host Species for Licensed Use:
Human
h. Allergen:
Neomycin, Polymyxin B
i. Immunization Route
Intramuscular injection (i.m.)
j. Storage
Store at 2° to 8°C (35° to 46°F), do not freeze.
k . Approved Age for Licensed Use
4 years of age and older.
l. Description
BOOSTRIX®-POLIO (combined diphtheria, tetanus, acellular pertussis and inactivated poliomyetitis) vaccine contains diphtheria toxoid, tetanus toxoid, three purified pertussis antigens [pertussis toxoid (PT), filamentous haemagglutinin (FHA) and pertactin (69 kDalton outer membrane protein)] adsorbed onto aluminum salts and inactivated polio virus types 1, 2 and 3. (GSK: Boostrix-Polio)
A DNA fragment encoding a kanamycin resistance determinant was used to insertionally inactivate the cloned aroA gene of Bordetella pertussis in Escherichia coli K-12, and a conjugative shuttle vector system based on the suicide vector pRTP1 was used to deliver the mutations from E. coli back into B. pertussis CN2992FS and BP1. The aroA mutation was introduced by allelic exchange into the chromosome of B. pertussis, resulting in otherwise isogenic parental and aroA mutant pairs. The B. pertussis aroA mutants grew well on laboratory medium supplemented with aromatic compounds but failed to grow on unsupplemented medium (Roberts et al., 1990).
f. Immunization Route
intracerebral challenge
g.
Mouse Response
Persistence:
The B. pertussis aroA mutants expressed the normal B. pertussis extracellular, virulence-associated proteins (Roberts et al., 1990).
Efficacy:
Mice exposed to three separate aerosols of live B. pertussis aroA bacteria were protected against lung colonization after being exposed to an aerosol containing the virulent parental B. pertussis strain. High-level antibodies against B. pertussis rapidly appeared in the sera of mice immunized by aerosol with the B. pertussis aroA strains and challenged with the virulent parent (Roberts et al., 1990).
The pertussis toxin gene, which encodes a highly virulent toxin (Mielcarek et al., 2006).
f. Vector:
Bordetella pertussis BPZE, which is attenuated for 3 different toxins: the pertussis toxin, the dermonecrotic toxin, and the tracheal cytotoxins (Mielcarek et al., 2006).
g. Immunization Route
intranasal immunization
h. Virulence
The pertussis toxin itself if extremely virulent, but after thorough and careful attenuation, the virulence is basically gone (Mielcarek et al., 2006).
i. Description
This is an intranasal vaccine because pathogenic B. pertussis colonizes the respiratory tract of humans. The vaccine itself has been shown to only need one inoculation in order to elicit protection, making it a good candidate to be a vaccine vector for other diseases (Mielcarek et al., 2006).
j.
Mouse Response
Vaccination Protocol:
The mice were vaccinated with highly-attenuated B. pertussis in order to prepare for challenge with virulent wild-type B. pertussis (Mielcarek et al., 2006).
Vaccine Immune Response Type:
VO_0000287
Challenge Protocol:
After the mice had been inoculated with attenuated B. pertussis (which after a month had colonized the entire mouse respiratory tract) they were challenged with virulent wild-type B. pertussis (Mielcarek et al., 2006).
Efficacy:
A single intranasal inoculation of mice with the B. pertussis vaccine vector induced the same level of protection, if not higher, as two injections of the commercial acellular vaccine (Mielcarek et al., 2006) .
Description:
Inoculation with the B. pertussis vaccine vector shows protective immunity which rivals that of the vaccines currently on the market.
his strain was obtained by genetically inactivating pertussis toxin via two point mutations in the ptx gene, by deleting dnt encoding dermonecrotic toxin, and by replacing the B. pertussis ampG gene by Escherichia coli ampG, resulting in the removal of tracheal cytotoxin (Feunou et al., 2008).
f. Immunization Route
intranasal immunization
g.
Mouse Response
Persistence:
The dnt mutant in B. pertussis yielded a highly attenuated strain that was still able to transiently colonize the mouse respiratory tract [Ref1805:Feunou et al., 2008.
Efficacy:
A single intranasal administration of BPZE1(dnt mutant vaccine) induced full protection in adult mice (8 weeks old), as well as in infant mice (3 weeks old), whereas commercial acellular pertussis vaccine (aPV) only partially protected infant mice, even after repetitive doses (Feunou et al., 2008).
16. DAPTACEL
a. Product Name:
Diphtheria and Tetanus Toxoids and Acellular Pertussis Vaccine Adsorbed
Description:
DAPTACEL is a vaccine indicated for active immunization against diphtheria, tetanus and pertussis as a five-dose series in infants and children 6 weeks through 6 years of age.
l. Preparation
Clostridium tetani is grown in modified Mueller-Miller casamino acid medium without beef heart infusion. Tetanus toxin is detoxified with formaldehyde and purified by ammonium sulfate fractionation and diafiltration (FDA: DAPTACEL).
m. Immunization Route
Intramuscular injection (i.m.)
n. Storage
Should be stored at 2° to 8°C (35° to 46°F). DO NOT FREEZE.
o . Approved Age for Licensed Use
DAPTACEL is a vaccine indicated for active immunization against diphtheria, tetanus and pertussis as a five dose series in infants and children 6 weeks through 6 years of age (prior to 7th birthday) (FDA: DAPTACEL).
p. Contraindication
Severe allergic reaction (e.g. anaphylaxis) after a previous dose of any diphtheria toxoid, tetanus toxoid, or pertussis-containing vaccine, or any component of DAPTACEL, encephalopathy within 7 days of a previous pertussis-containing vaccine with no other identifiable cause and, progressive neurologic disorder until a treatment regimen has been established and the condition has stabilized (FDA: DAPTACEL).
q. Description
DAPTACEL is a vaccine indicated for active immunization against diphtheria, tetanus and pertussis as a five-dose series in infants and children 6 weeks through 6 years of age.
17. Infanrix
a. Product Name:
Diphtheria and Tetanus Toxoids and Acellular Pertussis Vaccine Adsorbed
Tetanus toxin is produced by growing Clostridium tetani in a modified Latham medium derived from bovine casein. The toxin is detoxified with formaldehyde, concentrated by ultrafiltration, and purified by precipitation, dialysis, and sterile filtration (FDA: Infanrix).
m. Immunization Route
Intramuscular injection (i.m.)
n. Storage
Store INFANRIX refrigerated between 2° and 8°C (36° and 46°F). Do not freeze.
o . Approved Age for Licensed Use
INFANRIX is indicated for active immunization against diphtheria, tetanus, and pertussis (whooping cough) as a 5-dose series in infants and children 6 weeks to 7 years of age (prior to seventh birthday). INFANRIX should not be administered to any infant before the age of 6 weeks, or to individuals 7 years of age or older (FDA: Infanrix).
p. Contraindication
Hypersensitivity to any component of the vaccine is a contraindication, the vaccine should not be administered to anyone with encephalopathy, progressive neurological disorders, or an allergic reaction to a previous dose (FDA: Infanrix).
q. Description
The vaccine is an noninfectious, sterile combination of diphtheria and tetanus toxoids and 3 pertussis antigens [inactivated pertussis toxin (PT), filamentous hemagglutinin (FHA), and pertactin (69 kiloDalton outer membrane protein)] adsorbed onto aluminum hydroxide (FDA: Infanrix).
18. Infanrix -IPV/Hib
a. Product Name:
Diphtheria, tetanus, pertussis (acellular component), poliomyelitis (inactivated) and Haemophilus type b conjugate vaccine (adsorbed)
Combined diphtheria and tetanus toxoids, acellular pertussis, hepatitis B (recombinant), inactivated poliomyelitis and adsorbed conjugated Haemophilus influenzae type b vaccine
Toxoid vaccine + Subunit vaccine + Inactivated or "killed" vaccine
f. Status:
Licensed
g. Location Licensed:
USA
h. Host Species for Licensed Use:
Human
i. Allergen:
Latex, Neomycin, Polymyxin B.
j. Preparation
The diphtheria toxin is produced by growing Corynebacterium diphtheriae in Fenton medium containing a bovine extract. After, they are detoxified with formaldehyde, concentrated by ultrafiltration, and purified by precipitation, dialysis, and sterile filtration.
k. Immunization Route
Intramuscular injection (i.m.)
l. Storage
Store refrigerated between 2° and 8°C (36° and 46°F), do not freeze.
m . Approved Age for Licensed Use
4 to 6 years of age.
n. Contraindication
A severe allergic reaction (e.g., anaphylaxis) after a previous dose of any diphtheria toxoid, tetanus toxoid, pertussis or poliovirus-containing vaccine, or to any component of KINRIX, including neomycin and polymyxin B, encephalopathy within 7 days of administration of a previous pertussis-containing vaccine and progressive neurologic disorders.
o. Description
A single dose of KINRIX is indicated for active immunization against diphtheria, tetanus, pertussis, and poliomyelitis as the fifth dose in the diphtheria, tetanus, and acellular pertussis (DTaP) vaccine series and the fourth dose in the inactivated poliovirus vaccine (IPV) series in children 4 through 6 years of age whose previous DTaP vaccine doses have been with INFANRIX and/or PEDIARIX for the first three doses and INFANRIX for the fourth dose. (FDA: KINRIX)
23. Pediacel
a. Product Name:
Diphtheria and Tetanus Toxoids and Acellular Pertussis Vaccine Adsorbed Combined with Inactivated Poliomyelitis Vaccine and Haemophilus b Conjugate Vaccine (Tetanus Protein – Conjugate)
The diphtheria toxin is produced by growing Corynebacterium diphtheriae in Fenton medium containing a bovine extract. The diphtheria, tetanus, and pertussis antigens are individually adsorbed onto aluminum hydroxide then diluted and combined to produce the final formulated vaccine (FDA: Pediarix).
m. Immunization Route
Intramuscular injection (i.m.)
n. Storage
The vaccine should be refrigerated between 2º and 8ºC (36º and 46ºF). Do not freeze.
o . Approved Age for Licensed Use
PEDIARIX is indicated for active immunization against diphtheria, tetanus, pertussis (whooping cough), all known subtypes of hepatitis B virus, and poliomyelitis caused by poliovirus Types 1, 2, and 3 as a three-dose primary series in infants born of HBsAg-negative mothers, beginning as early as 6 weeks of age. PEDIARIX should not be administered to any infant before the age of 6 weeks, or to individuals 7 years of age or older.
p. Contraindication
Hypersensitivity to any component of the vaccine, including yeast, neomycin, and polymyxin B, is a contraindication. The vaccine should also not be administered to anyone with a previous allergic reaction to a dose of the vaccine (FDA: Pediarix).
q. Description
It contains diphtheria and tetanus toxoids, 3 pertussis antigens (inactivated pertussis toxin [PT] and formaldehyde-treated filamentous hemagglutinin [FHA] and pertactin [69 kiloDalton outer membrane protein]), hepatitis B surface antigen, plus poliovirus Type 1 (Mahoney), Type 2 (MEF-1), and Type 3 (Saukett) (FDA: Pediarix).
25. Pentacel
a. Product Name:
Diphtheria and Tetanus Toxoids and Acellular Pertussis Adsorbed, Inactivated Poliovirus and Haemophilus b Conjugate (Tetanus Toxoid Conjugate) Vaccine
Corynebacterium diphtheriae is grown in modified Mueller’s growth medium. After purification by ammonium sulfate fractionation, the diphtheria toxin is detoxified with formaldehyde and diafiltered (FDA: Pentacel).
n. Immunization Route
Intramuscular injection (i.m.)
o. Storage
Store at 2° to 8°C (35° to 46°F). Do not freeze.
p . Approved Age for Licensed Use
6 weeks to 4 years of age.
q. Contraindication
A severe allergic reaction (e.g., anaphylaxis) after a previous dose of Pentacel vaccine, any ingredient of this vaccine, or any other tetanus toxoid, diphtheria toxoid, pertussis-containing vaccine, inactivated poliovirus vaccine or H influenzae type b vaccine is a contraindication (FDA: Pentacel).
r. Description
It consists of a Diphtheria and Tetanus Toxoids and Acellular Pertussis Adsorbed and Inactivated Poliovirus (DTaP-IPV) component and an ActHIB® vaccine component. Pentacel vaccine is indicated for active immunization against diphtheria, tetanus, pertussis, poliomyelitis and invasive disease due to Haemophilus influenzae type b (FDA: Pentacel).
26. Quadracel
a. Product Name:
Diphtheria and Tetanus Toxoids and Acellular Pertussis Vaccine Adsorbed Combined with Inactivated Poliomyelitis Vaccine
BCG vaccine with S1 subunit of detoxified B. pertussis toxin; PT-9K/129G (Nascimento et al., 2008).
f. Immunization Route
Intramuscular injection (i.m.)
g.
Mouse Response
Vaccination Protocol:
Mice were immunized with 50μl of one-tenth dose of an adult mouse of DTP at day 5 (or day 12 as specified) or 10^5 CFU of BCG or rBCG-S1PT on day 5 according to different regimens (Nascimento et al., 2008).
Vaccine Immune Response Type:
VO_0003057
Challenge Protocol:
Mice were subjected to intracerebral inoculation with a lethal dose of B. pertussis with approximately 3 x 10^4, 3 x 10^5, or 9 x 10^5 CFU (in 30μl) on day 21 after birth.
Efficacy:
A single dose of rBCG-S1PT at day 5 led to a 100% survival of mice, and even at an extremely high challenge dose (300 times the lethal adult dose) rBCG-S1PT still induced 50% survival of neonate-immunized mice. Mice immunized with BCG alone experienced a protective effect of 80%, however at a higher challenge dose, this effect was reduced to 50%. Mice immunized with DTP showed no protection (Nascimento et al., 2008).
Description:
Tripedia vaccine combines diptheria and tetanus toxoids with purified pertussis antigens. It consists of 3 doses administered at intervals of 4-8 weeks (FDA: Tripedia).
k. Immunization Route
Intramuscular injection (i.m.)
l. Storage
Store between 2 and 8 degrees Celsius. DO NOT FREEZE.
m . Approved Age for Licensed Use
Tripedia vaccine is indicated for active immunization against diphtheria, tetanus, and pertussis simultaneously in infants and children 6 weeks to 7 years of age (prior to seventh birthday). Due to substantial risks of complications of the disease, completion of a primary series of pertussis vaccine early in life is strongly recommended (FDA: Tripedia).
n. Contraindication
This vaccine should not be administered to anyone with a known hypersensitivity to any component of the vaccine.
o. Description
Tripedia vaccine combines diptheria and tetanus toxoids with purified pertussis antigens. It consists of 3 doses administered at intervals of 4-8 weeks (FDA: Tripedia).
Description:
An attenuated strain of Vibrio cholerae was used as a carrier for the expression of heterologous antigens such as fragment C from tetanus toxin (TetC) and tracheal colonization factor from Bordetella pertussis (Tcf) (Chen et al., 1998).
An attenuated strain of Vibrio cholerae was used as a carrier for the expression of heterologous antigens such as fragment C from tetanus toxin (TetC) and tracheal colonization factor from Bordetella pertussis (Tcf) (Chen et al., 1998).
h. Immunization Route
intranasal immunization
i.
Mouse Response
Vaccine Immune Response Type:
VO_0000287
Challenge Protocol:
Mice were challenged with wild-type B. pertussis (Chen et al., 1998).
Efficacy:
Mice vaccinated with IEM101 expressing Tcf experienced significant reduction in bacterial colonization of their tracheas (Chen et al., 1998).
V. References
1. Bruss and Siber, 2002: Bruss JB, Siber GR. Quantitative priming with inactivated pertussis toxoid vaccine in the aerosol challenge model. Infection and immunity. 2002; 70(8); 4600-4608. [PubMed: 12117973].
2. Cainelli et al., 2007: Cainelli Gebara VC, Risoléo L, Lopes AP, Ferreira VR, Quintilio W, Lépine F, Silva WD, Raw I. Adjuvant and immunogenic activities of the 73kDa N-terminal alpha-domain of BrkA autotransporter and Cpn60/60kDa chaperonin of Bordetella pertussis. Vaccine. 2007; 25(4); 621-629. [PubMed: 17011680].
3. Chen et al., 1998: Chen I, Finn TM, Yanqing L, Guoming Q, Rappuoli R, Pizza M. A recombinant live attenuated strain of Vibrio cholerae induces immunity against tetanus toxin and Bordetella pertussis tracheal colonization factor. Infection and immunity. 1998; 66(4); 1648-1653. [PubMed: 9529093].
13. Fennelly et al., 2008: Fennelly NK, Sisti F, Higgins SC, Ross PJ, van der Heide H, Mooi FR, Boyd A, Mills KH. Bordetella pertussis expresses a functional type III secretion system that subverts protective innate and adaptive immune responses. Infection and immunity. 2008; 76(3); 1257-1266. [PubMed: 18195025].
14. Feunou et al., 2008: Feunou PF, Ismaili J, Debrie AS, Huot L, Hot D, Raze D, Lemoine Y, Locht C. Genetic stability of the live attenuated Bordetella pertussis vaccine candidate BPZE1. Vaccine. 2008; 26(45); 5722-5727. [PubMed: 18762220].
19. Guiso et al., 1989: Guiso N, Rocancourt M, Szatanik M, Alonso JM. Bordetella adenylate cyclase is a virulence associated factor and an immunoprotective antigen. Microbial pathogenesis. 1989; 7(5); 373-380. [PubMed: 2622329].
20. Kamachi et al., 2003: Kamachi K, Konda T, Arakawa Y. DNA vaccine encoding pertussis toxin S1 subunit induces protection against Bordetella pertussis in mice. Vaccine. 2003; 21(31); 4609-4615. [PubMed: 14575775].
21. Kinnear et al., 2001: Kinnear SM, Marques RR, Carbonetti NH. Differential regulation of Bvg-activated virulence factors plays a role in Bordetella pertussis pathogenicity. Infection and immunity. 2001; 69(4); 1983-1993. [PubMed: 11254549].
22. Komatsu et al., 2010: Komatsu E, Yamaguchi F, Abe A, Weiss AA, Watanabe M. Synergic effect of genotype changes in pertussis toxin and pertactin on adaptation to an acellular pertussis vaccine in the murine intranasal challenge model. Clinical and vaccine immunology : CVI. 2010; 17(5); 807-812. [PubMed: 20357056].
23. Lee et al., 1999: Lee SF, March RJ, Halperin SA, Faulkner G, Gao L. Surface expression of a protective recombinant pertussis toxin S1 subunit fragment in Streptococcus gordonii. Infection and immunity. 1999; 67(3); 1511-1516. [PubMed: 10024603].
24. Merkel et al., 1998: Merkel TJ, Stibitz S, Keith JM, Leef M, Shahin R. Contribution of regulation by the bvg locus to respiratory infection of mice by Bordetella pertussis. Infection and immunity. 1998; 66(9); 4367-4373. [PubMed: 9712789].
25. Mielcarek et al., 2006: Mielcarek N, Debrie AS, Raze D, Quatannens J, Engle J, Goldman WE, Locht C. Attenuated Bordetella pertussis: new live vaccines for intranasal immunisation. Vaccine. 2006; 24 Suppl 2; S2-54-5. [PubMed: 16823926].
26. Nascimento et al., 2008: Nascimento IP, Dias WO, Quintilio W, Christ AP, Moraes JF, Vancetto MD, Ribeiro-Dos-Santos G, Raw I, Leite LC. Neonatal immunization with a single dose of recombinant BCG expressing subunit S1 from pertussis toxin induces complete protection against Bordetella pertussis intracerebral challenge. Microbes and infection / Institut Pasteur. 2008; 10(2); 198-202. [PubMed: 18248757].
27. Novotny et al., 1985: Novotny P, Chubb AP, Cownley K, Montaraz JA, Beesley JE. Bordetella adenylate cyclase: a genus specific protective antigen and virulence factor. Developments in biological standardization. 1985; 61; 27-41. [PubMed: 2872113].
28. Novotny et al., 1991: Novotny P, Chubb AP, Cownley K, Charles IG. Biologic and protective properties of the 69-kDa outer membrane protein of Bordetella pertussis: a novel formulation for an acellular pertussis vaccine. The Journal of infectious diseases. 1991; 164(1); 114-122. [PubMed: 2056199].
31. Roberts et al., 1990: Roberts M, Maskell D, Novotny P, Dougan G. Construction and characterization in vivo of Bordetella pertussis aroA mutants. Infection and immunity. 1990; 58(3); 732-739. [PubMed: 2407655].
32. Salyers and Whitt., 2002: Abigail A. Salyers, Dixie D. Whitt. Bordetella pertussis. 263-73. Bacterial Pathogenesis: A Molecular Approach. 2002. ASM Press, Washington D.C. USA.
33. Sato and Sato, 1984: Sato H, Sato Y. Bordetella pertussis infection in mice: correlation of specific antibodies against two antigens, pertussis toxin, and filamentous hemagglutinin with mouse protectivity in an intracerebral or aerosol challenge system. Infection and immunity. 1984; 46(2); 415-421. [PubMed: 6542069].
34. Sukumar et al., 2007: Sukumar N, Mishra M, Sloan GP, Ogi T, Deora R. Differential Bvg phase-dependent regulation and combinatorial role in pathogenesis of two Bordetella paralogs, BipA and BcfA. Journal of bacteriology. 2007; 189(10); 3695-3704. [PubMed: 17351043].
