VIOLIN Logo
Virmugen Banner
Search: for Help
Virmugen Home
Introduction
Statistics
News and Updates
Virmugen Query
Virmugen Blast
Data Submission
Data Exchange
Data Download
Documentation
FAQs
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

Vaccine Comparison

Bordetella bronchiseptica aroA mutant vaccine (strain BBS18)
Vaccine Information
  • Vaccine Ontology ID: VO_0002801
  • Type: Live, attenuated vaccine
  • Status: Research
  • aroA gene engineering:
    • Type: Gene mutation
    • Detailed Gene Information: Click Here.
  • Preparation: A B. bronchiseptica aroA mutant was constructed by allelic exchange. Introduction of the Km-R cassette into the aroA gene of this strain was confirmed by PCR using aroA-specific primers (aroAfw 5′GGCGTGCAAAGCGGGGCGGACTGGCTGGAG3′ and aroArv 5′ATAATCGGGGAAAGTCTTGCTGACGCAGCC3′) and by Southern blotting and DNA:DNA hybridization using an aroA-specific probe generated by PCR (Stevenson and Roberts, 2002).
  • Immunization Route: intranasal immunization
References
Stevenson and Roberts, 2002: Stevenson A, Roberts M. Use of a rationally attenuated Bordetella bronchiseptica as a live mucosal vaccine and vector for heterologous antigens. Vaccine. 2002; 20(17-18); 2325-2335. [PubMed: 12009288].
Bordetella bronchiseptica aroA/trpE mutant vaccine
Vaccine Information
  • Vaccine Ontology ID: VO_0002802
  • Type: Live, attenuated vaccine
  • Status: Research
  • Host Species as Laboratory Animal Model: Mouse
  • aroA gene engineering:
    • Type: Gene mutation
    • Description: This aroA/trpE mutant is from Bordetella bronchiseptica (McArthur et al., 2003).
    • Detailed Gene Information: Click Here.
  • trpE gene engineering:
    • Type: Gene mutation
    • Description: This aroA/trpE mutant is from Bordetella bronchiseptica (McArthur et al., 2003).
    • Detailed Gene Information: Click Here.
  • Immunization Route: intranasal immunization
References
McArthur et al., 2003: McArthur JD, West NP, Cole JN, Jungnitz H, Guzmán CA, Chin J, Lehrbach PR, Djordjevic SP, Walker MJ. An aromatic amino acid auxotrophic mutant of Bordetella bronchiseptica is attenuated and immunogenic in a mouse model of infection. FEMS microbiology letters. 2003; 221(1); 7-16. [PubMed: 12694904].
Bordetella bronchiseptica bscN and cyaA double mutant vaccine
Vaccine Information
  • Vaccine Ontology ID: VO_0002803
  • Type: Live, attenuated vaccine
  • Status: Research
  • bscN gene engineering:
    • Type: Gene mutation
    • Detailed Gene Information: Click Here.
  • cyaA gene engineering:
    • Type: Gene mutation
    • Detailed Gene Information: Click Here.
  • Preparation: An isogenic mutant of RB50 containing an in-frame deletion of the adenylate cyclase toxin gene (cyaA), was constructed with an in-frame deletion of the ATPase (bscN) gene required for type III secretion (Mann et al., 2007).
  • Immunization Route: intranasal immunization
References
Mann et al., 2007: Mann P, Goebel E, Barbarich J, Pilione M, Kennett M, Harvill E. Use of a genetically defined double mutant strain of Bordetella bronchiseptica lacking adenylate cyclase and type III secretion as a live vaccine. Infection and immunity. 2007; 75(7); 3665-3672. [PubMed: 17452472].
Bordetella bronchiseptica dnt mutant vaccine
Vaccine Information
  • Vaccine Ontology ID: VO_0002805
  • Type: Live, attenuated vaccine
  • Status: Research
  • dnt gene engineering:
    • Type: Gene mutation
    • Detailed Gene Information: Click Here.
  • Preparation: Dom+ Scs+ Hly+ organisms of strain L3 were streaked on two BG-20 agar plates and incubated at 37°C. Ten Dom+ Scs+ Hly- colonies (0.5 to 0.7mm in diameter) grown on each plate were subcultured 10 times under the same culture conditions. Finally, four mutant strains showing the Dom+ Scs+ Hly -phenotype and lacking DNT- producing ability were obtained (Nagano et al., 1988).
  • Immunization Route: intranasal immunization
References
Nagano et al., 1988: Nagano H, Nakai T, Horiguchi Y, Kume K. Isolation and characterization of mutant strains of Bordetella bronchiseptica lacking dermonecrotic toxin-producing ability. Journal of clinical microbiology. 1988; 26(10); 1983-1987. [PubMed: 3182989].