VIOLIN Logo
Vaegen Banner
Search: Help
Vaegen Home
Introduction
Statistics
Vaegen quary
Vaegen BLAST
Gene Enrich Analyse
Data Submission
Data Exchange
Data Download
FAQs
Disclaimer
Contact Us
UMMS Logo
Record Information
Record ID 63
Pubmed ID 30088198
SNP B40
Gene ID 3106
Protein ID P01889
Vaccine Adverse Events chronic hepatitis B
Vaccine Hepatitis B recombinant vaccine
Gene Name HLA-B
Official Symbol major histocompatibility complex, class I, B [Homo sapiens (human)]
Aliases AS, B-4901, HLAB
Other Designations major histocompatibility complex, class I, B; HLA class I antigen HLA-B; HLA class I histocompatibility antigen, B alpha chain; MHC HLA-B cell surface glycoprotein; MHC HLA-B transmembrane glycoprotein; MHC class 1 antigen; MHC class I antigen HLA-B alpha chain; MHC class I antigen HLA-B heavy chain; MHC class I antigen SHCHA; MHC class I molecule; leukocyte antigen class I-B
Chromosome 6
Location 6p21.33
Annotation Chromosome 6 NC_000006.12 (31353875..31357179, complement)
MIM 142830
DNA Sequence >NC_000006.12:31353875-31357179 Homo sapiens chromosome 6, GRCh38.p14 Primary Assembly TGGAAGGTTCTCAGGTCTTTATTTGCTCTCTCAAATTCCAGGAATTGACTTATTTAATTAATCCATCAAC CTCTCATAGCAAATATTTGAGAAAACAAATTTATATTCAGATTCTTATTTTCAGTAGGGAAGTAAGAAGT TGCAGCTCAGTGCACGTAAAGTTGAGACAGAGATGGAGACATCCAGCCCCACCTCTCTGGAACAAGAAAG ATGACTGGGGAGGAAACACAGGTCAGCATGGGAACAGGGGTCACAGTGGACACAAGGGTGGGCTGTCTCT CCACCTCCTCACATTATGCTAACAGGGACGCAGACACATTCAGGTGCCTTTGCAGAAAGAGATGCCAGAG GCTCTTGAAGTCACAAAGGGGAGGCGTGAAGAAATCCTGCATCTCAGTCCCTCACAAGACAGCTGTCTCA GGCTACAGAAAACAACAGTCATGAACAAATTCTGGTTAGTCATGGTAAGCGATGACACTCTAAACAGCCC ACCACACACGCGAAACATCCCAATCAAAGAATCCCCATTACCCAGGCCTTTCCCCTCTGCCCCACCCACC CCCAGACCCGCCACCCCACCCACTCTAGACCCCAAGAATCTCACCTTTTCAAGCTGTGAGAGACACATCA GAGCCCTGGGCACTGTCGCTGCCTGGAGTAGAACAAAAACAGGACCTGGTCAGAGCCCGCAGGAGACGTG GGACAGGAGGAATTATGGGGTGGGTGAGCTCCTCCACACTCCCACCCCCACCACTTACACGCAGCCTGAG AGTAGCTCCCTCCTTTTCCACCTGTGGGAAGAAAATGTCCTGTGAGGGCACTGGGAGGAAGCAGGGCCAT GAGATCTTAGAGGAACCTCCTAGTCTTGGACCCAAAAGGAATTTCCAGAAGTATGACTACAGACCCAGGG CAGGATCAGGAAACACGAGGAAAGCAAGTGTGGGTCCTGGACCAACTGCCCTCCTAAGGTCTGTCCTTAG CAGGGACCTTCCCCTGACTCATGAATGCTGGAATCAGGACCCCAACACCACAACCATCAAGGTGATACAT CCATCCTTCATTGTCACATGTGCTGCACAAAAGAGTAAGTGCTGGCACACAGGGTCCCAGGCTGCGTTAG CCCCTGTGTGCATGCTGCTTCCCAGTAATGAGGCAGGGAACACTTCTACCTGGGGCTTGAAACCCCCAGT GGGACAAGAAAACCCAGACCCCACCCCTCACCCCTTCCCTACCTGAACTCTTCCTCCTACACATCACAGC AGCGACCACAGCTCCGATGACCACAACTGCTAGGACAGCCAGGCCAGCAACAATGCCCACGATGGGGACG GTGGACTGGGAAGACGGCTCTGGGAAAGGAGGGGAAGATGAGGGGCCCTGACCCTGCTGAAGGGCTCCTG CTTTCCCTGAGAAGAGATATGACCCCTCATCCCCCTCCTTACCCCATCTCAGGGTGAGGGGCTTCGGCAG CCCCTCATGCTGTACATGGCATGTGTATCTCTGCTCTTCTCCAGAAGGCACCACCACAGCTGCCCACTTC TGGAAGGTTCTATCTCCTGCTGGTCTGGTCTCCACAAGCTCAGTGTCCTGAGTTTGGTCCTCGCCATCCC GCTGCCAGGTCAGTGTGATCTCCGCAGGGTAGAAACCCAGGGCCCAGCACCTCAGGGTGGCCTCATGGTC AGAGATGGGGTGGTGGGTCACGTGTGTCTTTGGGGGGTCTGATGGGAAGAGTCAGAAAATTCAGGCGCTT TGCATCTTTCATGGGACACCCTAGGACCACCCATGTGACCAGCCTGAGAATGGACAGGACACCTGGGGTG GGGAAGGGGCACAGAACCCAGACACCAGCCTGGACGCAGGCACCTGGGATAATCTCCTATTCATTGGAAA GTTCGAGTCTCTGAGCGGGGAACAGGGACTTCTGCTCCTGATCTGAGTGGAGGTAAAGTGACTCAGAAGT GCTGGAATCAGAGCCCCAAACACACTGAGTGTGAGGCAGAGAACAAGGCCTGAGAGGAAAAGTCACGGTT CCCAAGGCTGCTGCAGGGGTCAAAGGGGACCCCTGATCAGTATTCTAGGGACTGTCTTCCCCTCCATTTC CTCAGAGACGTCATTCCTTAATTGTCTAGAGAGAAGAGGGGGCCCTCAGAGGAAACTCAGGAAAACTCAT GCCATTCTCCATTCAACGGAGGGCGACATTCTAGCGCTGATCCCATTTTCCTCCTCTTCTCGTGGGAGGC CATCCCCGGCGACCTATAGGAGATGGGGAAGGCTCCCCACTGCCCCTGGTACCAGCGCGCTCCAGCTTGT CCTTCCCGTTCTCCAGGTATCTGCGGAGCCACTCCACGCACTCGCCCTCCAGGTAGGCTCTCCGCTGCTC CGCCTCACGGGCCGCCTCCCACTTGCGCTGGGTGATCTGAGCCGCCGTGTCCGCGGCGGTCCAGGAGCGC AGGTCCTCGTTCAGGGCGATGTAATCCTTGCCGTCGTAGGCGTACTGGTCATGCCCGCGGAGGAGGCGCC CGTCCGGCCCCACGTCGCAGCCGTACATGCTCTGGAGGGTGTGAGACCCTGGCCCCGGCCCCGCGGTCAG CCCAGTCCCCCGAGCCCCGCCCCGCCCCGACCAACCCGCGGGGATTTTGGCCTCAACTGAAAATGAAACC GGGTAAACGCGCCTGGGGCTCTCGCCGGTCGAGGGTCTGGGCGGGTCCCGCGGCCTCAGGGAGGCGGATC TCGGACCCGGAGACTCGGGGCGACCCGGGCCGTACGTGGGGGATGGGGAGTCGTGACCTGCGCCCCGGGC CGGGGTCACTCACCGGCCTCGCTCTGGTTGTAGTAGCCGCGCAGGTTCCGCAGGCTCTCTCGGTCAGTCT GTGCCTGGGCCTTGTAGATCTGTGTGTTCCGGTCCCAATACTCCGGCCCCTCCTGCTCTATCCACGGCGC CCGCGGCTCCTCTCTCGGACTCGCGGCGTCGCTGTCGAACCTCACGAACTGGGTGTCGTCCACGTAGCCC ACTGAGATGAAGCGGGGCTCCCCGCGGCCGGGCCGGGACACGGAGGTGTAGAAATACCTCATGGAGTGGG AGCCTGGGGGTGAGGAGGGGCTGAGACCCGCCCGACCCTCCTCCCGGCGCGGCTCCTCAGGTCCTGCGCC CCCGCCTGCGGTCCCCTCGCTCCTCCCGGCAGAGGCCATTTCCCTCCCGACCCGCACTCACCGGCCCAGG TCTCGGTCAGGGCCAGGGCCGCCGAGAGCAGCAGGAGGACGGTTCGGGGCGCCATGACCAGCATCTCGGC GTCTGAGGAGACTCT
Protein Name HLAB_HUMAN
Length 362
Moltype AA
Topology linear
Division PRI
Update Date 12-OCT-2022
Create Date 21-JUL-1986
Definition RecName: Full=HLA class I histocompatibility antigen, B alpha chain; AltName: Full=Human leukocyte antigen B; Short=HLA-B; Flags: Precursor
Primary Accession P01889
Accession Version P01889.3
Other SeqIDs sp|P01889.3|HLAB_HUMAN,gi|122162
Organism Homo sapiens
Taxonomy Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo
Comment On or before Oct 18, 2019 this sequence version replaced P03989.2, P10319.1, P18463.1, P18464.1, P18465.1, P30460.1, P30461.1, P30462.1, P30464.2, P30466.1, P30475.1, P30479.1, P30480.1, P30481.1, P30483.1, P30484.1, P30485.1, P30486.1, P30487.2, P30488.1, P30490.1, P30491.1, P30492.1, P30493.1, P30495.1, P30498.1, P30685.1, Q04826.1, Q29718.1, Q29836.1, Q29940.1, Q31610.1, Q31612.1, Q95365.1, gi:74756019, gi:2118804, gi:1070580, gi:2118821, gi:2146955.; [FUNCTION] Antigen-presenting major histocompatibility complex class I (MHCI) molecule. In complex with B2M/beta 2 microglobulin displays primarily viral and tumor-derived peptides on antigen-presenting cells for recognition by alpha-beta T cell receptor (TCR) on HLA-B-restricted CD8-positive T cells, guiding antigen-specific T cell immune response to eliminate infected or transformed cells (PubMed:25808313, PubMed:29531227, PubMed:9620674, PubMed:23209413). May also present self-peptides derived from the signal sequence of secreted or membrane proteins, although T cells specific for these peptides are usually inactivated to prevent autoreactivity (PubMed:7743181, PubMed:18991276). Both the peptide and the MHC molecule are recognized by TCR, the peptide is responsible for the fine specificity of antigen recognition and MHC residues account for the MHC restriction of T cells (PubMed:29531227, PubMed:9620674, PubMed:24600035). Typically presents intracellular peptide antigens of 8 to 13 amino acids that arise from cytosolic proteolysis via constitutive proteasome and IFNG-induced immunoproteasome (PubMed:23209413). Can bind different peptides containing allele-specific binding motifs, which are mainly defined by anchor residues at position 2 and 9 (PubMed:25808313, PubMed:29531227). {ECO:0000269|PubMed:18991276, ECO:0000269|PubMed:23209413, ECO:0000269|PubMed:24600035, ECO:0000269|PubMed:25808313, ECO:0000269|PubMed:29531227, ECO:0000269|PubMed:7743181, ECO:0000269|PubMed:9620674}.; [FUNCTION] Allele B*07:02: Displays peptides sharing a common signature motif, namely a Pro residue at position 2 and mainly a Leu anchor residue at the C-terminus (PubMed:7743181). Presents a long peptide (APRGPHGGAASGL) derived from the cancer-testis antigen CTAG1A/NY-ESO-1, eliciting a polyclonal CD8-positive T cell response against tumor cells (PubMed:29531227). Presents viral epitopes derived from HIV-1 gag-pol (TPQDLNTML) and Nef (RPQVPLRPM) (PubMed:25808313). Presents an immunodominant epitope derived from SARS-CoV-2 N/nucleoprotein (SPRWYFYYL) (PubMed:32887977). Displays self-peptides including a peptide derived from the signal sequence of HLA-DPB1 (APRTVALTA) (PubMed:7743181). {ECO:0000269|PubMed:25808313, ECO:0000269|PubMed:29531227, ECO:0000269|PubMed:32887977, ECO:0000269|PubMed:7743181}.; [FUNCTION] Allele B*08:01: Presents to CD8-positive T cells viral epitopes derived from EBV/HHV-4 EBNA3 (QAKWRLQTL), eliciting cytotoxic T cell response. {ECO:0000269|PubMed:9620674}.; [FUNCTION] Allele B*13:02: Presents multiple HIV-1 epitopes derived from gag (RQANFLGKI, GQMREPRGSDI), nef (RQDILDLWI), gag-pol (RQYDQILIE, GQGQWTYQI) and rev (LQLPPLERL), all having in common a Gln residue at position 2 and mainly hydrophobic amino acids Leu, Ile or Val at the C-terminus. Associated with succesful control of HIV-1 infection. {ECO:0000269|PubMed:17251285}.; [FUNCTION] Allele B*18:01: Preferentially presents octomeric and nonameric peptides sharing a common motif, namely a Glu at position 2 and Phe or Tyr anchor residues at the C-terminus (PubMed:14978097, PubMed:23749632, PubMed:18991276). Presents an EBV/HHV-4 epitope derived from BZLF1 (SELEIKRY) (PubMed:23749632). May present to CD8-positive T cells an antigenic peptide derived from MAGEA3 (MEVDPIGHLY), triggering an anti-tumor immune response (PubMed:12366779). May display a broad repertoire of self-peptides with a preference for peptides derived from RNA-binding proteins (PubMed:14978097). {ECO:0000269|PubMed:12366779, ECO:0000269|PubMed:14978097, ECO:0000269|PubMed:18991276, ECO:0000269|PubMed:23749632}.; [FUNCTION] Allele B*27:05: Presents to CD8-positive T cells immunodominant viral epitopes derived from HCV POLG (ARMILMTHF), HIV-1 gag (KRWIILGLNK), IAV NP (SRYWAIRTR), SARS-CoV-2 N/nucleoprotein (QRNAPRITF), EBV/HHV-4 EBNA4 (HRCQAIRKK) and EBV/HHV-4 EBNA6 (RRIYDLIEL), confering longterm protection against viral infection (PubMed:19139562, PubMed:18385228, PubMed:15113903, PubMed:9620674, PubMed:32887977). Can present self-peptides derived from cytosolic and nuclear proteins. All peptides carry an Arg at position 2 (PubMed:1922338). The peptide-bound form interacts with NK cell inhibitory receptor KIR3DL1 and inhibits NK cell activation in a peptide-specific way, being particularly sensitive to the nature of the amino acid side chain at position 8 of the antigenic peptide (PubMed:8879234, PubMed:15657948). KIR3DL1 fails to recognize HLA-B*27:05 in complex with B2M and EBV/HHV-4 EBNA6 (RRIYDLIEL) peptide, which can lead to increased activation of NK cells during infection (PubMed:15657948). May present an altered repertoire of peptides in the absence of TAP1-TAP2 and TAPBPL (PubMed:9620674). {ECO:0000269|PubMed:15113903, ECO:0000269|PubMed:15657948, ECO:0000269|PubMed:18385228, ECO:0000269|PubMed:19139562, ECO:0000269|PubMed:1922338, ECO:0000269|PubMed:8879234, ECO:0000269|PubMed:9620674}.; [FUNCTION] Allele B*40:01: Presents immunodominant viral epitopes derived from EBV/HHV-4 LMP2 (IEDPPFNSL) and SARS-CoV-2 N/nucleoprotein (MEVTPSGTWL), triggering memory CD8-positive T cell response (PubMed:18991276, PubMed:32887977). Displays self-peptides sharing a signature motif, namely a Glu at position 2 and a Leu anchor residue at the C-terminus (PubMed:18991276). {ECO:0000269|PubMed:18991276, ECO:0000269|PubMed:32887977}.; [FUNCTION] Allele B*41:01: Displays self-peptides sharing a signature motif, namely a Glu at position 2 and Ala or Pro anchor residues at the C-terminus. {ECO:0000269|PubMed:18991276}.; [FUNCTION] Allele B*44:02: Presents immunodominant viral epitopes derived from EBV/HHV-4 EBNA4 (VEITPYKPTW) and EBNA6 (AEGGVGWRHW, EENLLDFVRF), triggering memory CD8-positive T cell response (PubMed:9620674, PubMed:18991276). Displays self-peptides sharing a signature motif, namely a Glu at position 2 and Phe, Tyr or Trp anchor residues at the C-terminus (PubMed:18991276). {ECO:0000269|PubMed:18991276, ECO:0000269|PubMed:9620674}.; [FUNCTION] Allele B*45:01: Displays self-peptides sharing a signature motif, namely a Glu at position 2 and Ala or Pro anchor residues at the C-terminus. {ECO:0000269|PubMed:18991276}.; [FUNCTION] Allele B*46:01: Preferentially presents nonameric peptides sharing a signature motif, namely Ala and Leu at position 2 and Tyr, Phe, Leu, or Met anchor residues at the C-terminus. The peptide-bound form interacts with KIR2DL3 and inhibits NK cell cytotoxic response in a peptide-specific way. {ECO:0000269|PubMed:28514659}.; [FUNCTION] Allele B*47:01: Displays self-peptides sharing a signature motif, namely an Asp at position 2 and Leu or Met anchor residues at the C-terminus. {ECO:0000269|PubMed:18991276}.; [FUNCTION] Allele B*49:01: Displays self-peptides sharing a signature motif, namely a Glu at position 2 and Ile or Val anchor residues at the C-terminus. {ECO:0000269|PubMed:18991276}.; [FUNCTION] Allele B*50:01: Displays self-peptides sharing a signature motif, namely a Glu at position 2 and Ala or Pro anchor residues at the C-terminus. {ECO:0000269|PubMed:18991276}.; [FUNCTION] Allele B*51:01: Presents an octomeric HIV-1 epitope derived from gag-pol (TAFTIPSI) to the public TRAV17/TRBV7-3 TCR clonotype, strongly suppressing HIV-1 replication. {ECO:0000269|PubMed:24600035}.; [FUNCTION] Allele B*54:01: Displays peptides sharing a common signature motif, namely a Pro residue at position 2 and Ala anchor residue at the C-terminus. {ECO:0000269|PubMed:7743181}.; [FUNCTION] Allele B*55:01: Displays peptides sharing a common signature motif, namely a Pro residue at position 2 and Ala anchor residue at the C-terminus. {ECO:0000269|PubMed:7743181}.; [FUNCTION] Allele B*56:01: Displays peptides sharing a common signature motif, namely a Pro residue at position 2 and Ala anchor residue at the C-terminus. {ECO:0000269|PubMed:7743181}.; [FUNCTION] Allele B*57:01: The peptide-bound form recognizes KIR3DL1 and inhibits NK cell cytotoxic response. {ECO:0000269|PubMed:22020283, ECO:0000269|PubMed:25480565}.; [FUNCTION] Allele B*67:01: Displays peptides sharing a common signature motif, namely a Pro residue at position 2 and Leu anchor residue at the C-terminus. {ECO:0000269|PubMed:7743181}.; [SUBUNIT] Heterotrimer that consists of an alpha chain HLA-B, a beta chain B2M and a peptide (peptide-HLA-B-B2M) (PubMed:25808313, PubMed:29531227, PubMed:15657948, PubMed:17057332, PubMed:22020283, PubMed:24600035). Early in biogenesis, HLA-B-B2M dimer interacts with the components of the peptide-loading complex composed of TAPBP, TAP1-TAP2, TAPBPL, PDIA3/ERP57 and CALR (PubMed:9036970, PubMed:9620674, PubMed:26439010, PubMed:26416272). Interacts with TAP1-TAP2 transporter via TAPBP; this interaction is obligatory for the loading of peptide epitopes delivered to the ER by TAP1-TAP2 transporter (PubMed:9036970, PubMed:9620674). Interacts with TAPBPL; TAPBPL binds peptide-free HLA-B-B2M complexes or those loaded with low affinity peptides, likely facilitating peptide exchange for higher affinity peptides (PubMed:26439010). Only optimally assembled peptide-HLA-B-B2M trimer translocates to the surface of antigen-presenting cells, where it interacts with TCR and CD8 coreceptor on the surface of T cells. HLA-B (via polymorphic alpha-1 and alpha-2 domains) interacts with antigen-specific TCR (via CDR1, CDR2 and CDR3 domains) (PubMed:29531227, PubMed:24600035). One HLA-B molecule (mainly via nonpolymorphic alpha-3 domain) interacts with one CD8A homodimer (via CDR-like loop); this interaction insures peptide-HLA-B-B2M recognition by CD8-positive T cells only (PubMed:29531227). Allele B*57:01 interacts (via Bw4 motif) with KIR3DL1 (via Ig-like C2-type domain); this interaction may interfere with peptide binding (PubMed:22020283, PubMed:25480565). Allele B*46:01 interacts with KIR2DL3 (PubMed:28514659). {ECO:0000269|PubMed:15657948, ECO:0000269|PubMed:17057332, ECO:0000269|PubMed:22020283, ECO:0000269|PubMed:24600035, ECO:0000269|PubMed:25480565, ECO:0000269|PubMed:25808313, ECO:0000269|PubMed:26416272, ECO:0000269|PubMed:26439010, ECO:0000269|PubMed:28514659, ECO:0000269|PubMed:29531227, ECO:0000269|PubMed:9036970, ECO:0000269|PubMed:9620674}.; [SUBUNIT] (Microbial infection) Interacts with HTLV-1 accessory protein p12I. {ECO:0000269|PubMed:11390610}.; [INTERACTION] P01889; P43626: KIR2DL1; NbExp=2; IntAct=EBI-1046513, EBI-8684277; P01889; P43628: KIR2DL3; NbExp=2; IntAct=EBI-1046513, EBI-8632435; P01889; P43632: KIR2DS4; NbExp=2; IntAct=EBI-1046513, EBI-13916812; P01889; Q14943: KIR3DS1; NbExp=6; IntAct=EBI-1046513, EBI-15316524; P01889; Q8N423: LILRB2; NbExp=2; IntAct=EBI-1046513, EBI-2816428; P01889; Q9BX59: TAPBPL; NbExp=3; IntAct=EBI-1046513, EBI-12017416.; [SUBCELLULAR LOCATION] Cell membrane {ECO:0000269|PubMed:25480565, ECO:0000269|PubMed:26439010, ECO:0000269|PubMed:9620674}; Single-pass type I membrane protein {ECO:0000255}. Endoplasmic reticulum membrane {ECO:0000305|PubMed:9620674}; Single-pass type I membrane protein {ECO:0000255}.; [DOMAIN] The alpha-1 domain is a structural part of the peptide-binding cleft (PubMed:25808313). Residues 101-107 determine Bw4/Bw6 motifs, which serologically distinguish HLA-B alleles. Each HLA-B allele posseses either the Bw4 or Bw6 motif. Only HLA-B alleles bearing the Bw4 epitope are recognized by NK cell inhibitory receptor KIR3DL1 (PubMed:25480565, PubMed:22020283). {ECO:0000269|PubMed:22020283, ECO:0000269|PubMed:25480565, ECO:0000269|PubMed:25808313}.; [DOMAIN] The alpha-2 domain is a structural part of the peptide-binding cleft (PubMed:25808313). Mediates the interaction with TAP1-TAP2 complex (By similarity). {ECO:0000250|UniProtKB:P04439, ECO:0000269|PubMed:25808313}.; [DOMAIN] The alpha-3 Ig-like domain mediates the interaction with CD8 coreceptor. {ECO:0000250|UniProtKB:P04439}.; [POLYMORPHISM] The most polymorphic of the mammalian genome. Polymorphic residues encode for alpha-1 and alpha-2 domains of the peptide-binding cleft, where they contribute to variations in peptide binding and TCR recognition among different alleles. The human population is estimated to have millions of HLA-B alleles. But only 17 common HLA-A alleles are considered core alleles, representing all functionally significant variation (polymorphism) in alpha-1 and alpha-2 domains. These are: B*07:02; B*08:01; B*13:02; B*15:01; B*18:01; B*27:05; B*35:01; B*37:01; B*38:01; B*40:01; B*44:02; B*45:01; B*51:01; B*54:01; B*57:01 and B*73:01. Among these, B*07:02; B*15:01; B*18:01; B*37:01; B*51:01; B*54:01; B*57:01 and B*73:01, were likely passed by introgression from archaic to modern humans. Functional alleles of more recent origin (non-core) were derived by recombination (PubMed:28650991). The sequence shown is that of B*07:02. The sequences of core alleles and common representative alleles of serologically distinct allele groups are described as variants of B*07:02. {ECO:0000269|PubMed:28650991}.; [DISEASE] Stevens-Johnson syndrome (SJS) [MIM:608579]: A rare blistering mucocutaneous disease that share clinical and histopathologic features with toxic epidermal necrolysis. Both disorders are characterized by high fever, malaise, and a rapidly developing blistering exanthema of macules and target-like lesions accompanied by mucosal involvement. Stevens-Johnson syndrome is a milder disease characterized by destruction and detachment of the skin epithelium and mucous membranes involving less than 10% of the body surface area. Ocular symptoms include ulcerative conjunctivitis, keratitis, iritis, uveitis and sometimes blindness. It can be caused by a severe adverse reaction to particular types of medication, although Mycoplasma infections may induce some cases. Note=Disease susceptibility is associated with variants affecting the gene represented in this entry. Increased susceptibility to Stevens-Johnson syndrome is conferred by allele B*15:02. {ECO:0000269|PubMed:15057820}.; [DISEASE] Spondyloarthropathy 1 (SPDA1) [MIM:106300]: A chronic rheumatic disease with multifactorial inheritance. It includes a spectrum of related disorders comprising ankylosing spondylitis, a subset of psoriatic arthritis, reactive arthritis (e.g. Reiter syndrome), arthritis associated with inflammatory bowel disease and undifferentiated spondyloarthropathy. These disorders may occur simultaneously or sequentially in the same patient, probably representing various phenotypic expressions of the same disease. Ankylosing spondylitis is the form of rheumatoid arthritis affecting the spine and is considered the prototype of seronegative spondyloarthropathies. It produces pain and stiffness as a result of inflammation of the sacroiliac, intervertebral, and costovertebral joints. Note=Disease susceptibility is associated with variants affecting the gene represented in this entry. A restricted number of HLA-B*27 subtypes can be associated with ankylosing spondylitis and other B*27-related diseases, and an elevated frequency of the B*27:02 allele in ankylosing spondylitis patients is identified. The allele B*27:07 seems to have a protective role in some populations because it was found only in the healthy controls. {ECO:0000269|PubMed:15603872}.; [DISEASE] Note=There is evidence that HLA-B*51 is associated with susceptibility to Behcet disease (BD). However, it is not certain whether HLA-B*51 itself or a closely linked gene is responsible for susceptibility. The world distribution of HLA-B*51 in healthy people corresponds to the global distribution of BD; in Southern hemisphere countries (Africa, South Pacific, etc.) and in some parts of Europe, the prevalence of HLA-B*51 in healthy people is low or null, corresponding to a low prevalence of BD. The wide variation that exists in the relative risk of HLA-B*51 would support other nongenetic risk factors. {ECO:0000269|PubMed:23291587}.; [DISEASE] Note=The presence of allele B*57:01 is associated with increased susceptibility to abacavir hypersensitivity [MIM:142830] in HIV-1 patients. {ECO:0000269|PubMed:11888582}.; [DISEASE] Note=Allele group B*08 is associated with increased susceptibility to rheumatoid arthritis, where affected individuals have antibodies to cyclic citrullinated peptide (anti-CCP-positive rheumatoid arthritis). {ECO:0000269|PubMed:22286218}.
Source Db UniProtKB: locus HLAB_HUMAN, accession P01889;; class: standard.; extra accessions:A0A2I6Q7B5,B0V0B8,G3GN01,O02862,O02956,O02957,O02960,O19555,O19556,O19595,O19615,O19624,O19625,O19627,O19641,O19651,O19675,O19692,O19758,O19779,O19783,O46702,O62897,O62901,O62915,O62917,O62919,O77933,O77959,O78053,O78138,O78160,O78163,O78172,O78173,O78180,O78217,O95730,O98140,P01890,P03989,P10317,P10318,P10319,P10320,P18463,P18464,P18465,P19373,P30460,P30461,P30462,P30463,P30464,P30465,P30466,P30467,P30468,P30469,P30470,P30471,P30472,P30473,P30474,P30475,P30476,P30477,P30478,P30479,P30480,P30481,P30482,P30483,P30484,P30485,P30486,P30487,P30488,P30489,P30490,P30491,P30492,P30493,P30494,P30495,P30496,P30497,P30498,P30513,P30685,P79489,P79490,P79496,P79504,P79523,P79524,P79542,P79555,Q04826,Q08136,Q29633,Q29636,Q29638,Q29661,Q29665,Q29678,Q29679,Q29681,Q29693,Q29695,Q29697,Q29718,Q29742,Q29749,Q29762,Q29764,Q29829,Q29836,Q29842,Q29845,Q29846,Q29847,Q29848,Q29850,Q29851,Q29852,Q29854,Q29855,Q29857,Q29858,Q29861,Q29924,Q29925,Q29933,Q29935,Q29936,Q29940,Q29953,Q29961,Q29982,Q30173,Q30198,Q31603,Q31610,Q31612,Q31613,Q546L8,Q546M4,Q5JP37,Q5QT24,Q5RIP1,Q5SRJ2,Q5TK76,Q5TK77,Q860I4,Q861B5,Q8HWF0,Q8MGQ3,Q8MHN4,Q8SNC5,Q95343,Q95344,Q95365,Q95369,Q95392,Q95HA3,Q95HA8,Q95HM9,Q95IA6,Q95IB8,Q95IH5,Q95J00,Q96IT9,Q9BCM6,Q9BCM7,Q9BCM8,Q9BD06,Q9BD38,Q9BD43,Q9GIL3,Q9GIM3,Q9GIX1,Q9GIY5,Q9GIZ0,Q9GIZ9,Q9GJ00,Q9GJ17,Q9GJ20,Q9GJ23,Q9GJ31,Q9GJF0,Q9GJM7,Q9MX21,Q9MY37,Q9MY42,Q9MY43,Q9MY61,Q9MY75,Q9MY78,Q9MY79,Q9MY84,Q9MY92,Q9MY93,Q9MY94,Q9MYB8,Q9MYC3,Q9MYC7,Q9MYF4,Q9MYG1,Q9TP35,Q9TP36,Q9TP37,Q9TP95,Q9TPQ7,Q9TPQ9,Q9TPR2,Q9TPR4,Q9TPS6,Q9TPT2,Q9TPT4,Q9TPT6,Q9TPV2,Q9TQG1,Q9TQH3,Q9TQH6,Q9TQH7,Q9TQH8,Q9TQH9,Q9TQM2,Q9TQN4,Q9TQN6,Q9UQS8,Q9UQT0; created: Jul 21, 1986.; sequence updated: Feb 1, 1991.; annotation updated: Oct 12, 2022.; xrefs: U03698.1, AAA03719.1, M32317.1, AAA36230.1, M32320.1, AAA36233.1, M32319.1, AAA36232.1, M32318.1, AAA36231.1, M77774.1, AAA03686.1, M77778.1, AAA03687.1, M77776.1, AAA03689.1, X61710.1, CAA43879.1, X61706.1, CAA43875.1, X61708.1, CAA43877.1, M24037.1, AAA02950.1, M84380.1, AAA59629.1, L09736.1, AAA36224.1, D14343.1, BAA03277.1, M83193.1, AAA58628.1, L07743.1, AAA59621.1, X77658.1, CAA54739.1, U03859.1, AAA03601.1, U04787.1, AAA53175.1, L24373.1, AAA96733.1, D50291.1, BAA08822.1, L37880.1, AAC41941.1, L36591.1, AAA73509.1, U04243.1, AAA87396.1, X90390.1, CAA62035.1, U36492.1, AAB18369.1, D50292.1, BAA08823.1, AB008102.1, BAA22916.1, M11799.1, AAA59628.1, X03665.1, CAA27302.1, X03666.1, M14013.1, AAA59643.1, M19757.1, AAA52657.1, M19756.1, AAA52664.1, M28115.1, AAA59617.1, M28109.1, M28110.1, M28111.1, M28112.1, M28113.1, M28114.1, L41087.1, AAA64513.1, L41086.1, M24036.1, AAA52662.1, M24041.1, AAA59660.1, M24040.1, AAA59661.1, M24035.1, AAA59666.1, M24039.1, AAA59662.1, M24034.1, AAA59667.1, M24038.1, AAA59663.1, M24033.1, AAA59665.1, M58636.1, AAA36228.1, M33573.1, AAA59644.1, X55711.1, CAA39244.1, M94053.1, AAA52659.1, L41628.1, AAA65040.1, L17005.1, AAC37548.1, AJ292075.2, CAC33440.1, AJ295294.2, CAC18876.1, AJ310507.2, CAC34572.1, AJ309193.2, CAC38392.1, AJ309194.1, CAC38393.1, AJ458992.1, CAD30340.1, AJ310508.1, CAC34573.1, AJ308398.2, CAC33087.2, AJ309139.1, CAC38066.1, AJ310509.1, CAC34574.1, HM543719.1, ADU18071.1, HM543720.1, ADU18072.1, JF974053.1, AEN79482.1, U11267.1, AAA19927.1, U11261.1, AAA19921.1, D50300.1, BAA08829.1, U29057.1, AAA91229.1, U38800.1, AAC99997.1, U40498.1, AAD00010.1, AJ309936.1, CAC33891.1, AJ309047.1, CAC35468.1, AJ310358.1, CAC38763.1, AJ309192.1, CAC38391.1, MG525292.1, AUM84865.1, AY007140.1, AAG02001.1, BA000025.2, BAB63309.1, BC007243.1, AAH07243.1, AK313911.1, BAG36634.1, CR759828.5, NP_005505.2, 1A1M_A, 1A1N_A, 1A1O_A, 1A9B_A, 1A9B_D, 1A9E_A, 1AGB_A, 1AGC_A, 1AGD_A, 1AGE_A, 1AGF_A, 1CG9_A, 1E27_A, 1E28_A, 1HSA_A, 1HSA_D, 1JGD_A, 1JGE_A, 1K5N_A, 1M05_A, 1M05_C, 1M6O_A, 1MI5_A, 1N2R_A, 1OF2_A, 1OGT_A, 1SYS_A, 1SYV_A, 1UXS_A, 1UXW_A, 1W0V_A, 1W0W_A, 1XH3_A, 1XR8_A, 1XR9_A, 1ZHK_A, 1ZHL_A, 1ZSD_A, 2A83_A, 2AK4_A, 2AK4_F, 2AK4_K, 2AK4_Q, 2AXF_A, 2AXG_A, 2BSR_A, 2BSS_A, 2BST_A, 2BVO_A, 2BVP_A, 2BVQ_A, 2H6P_A, 2HJL_A, 2NW3_A, 2NX5_A, 2NX5_F, 2NX5_K, 2NX5_Q, 2RFX_A, 2YPK_A, 2YPL_A, 3B3I_A, 3B6S_A, 3BP4_A, 3BP7_A, 3BW9_A, 3BWA_A, 3C9N_A, 3CZF_A, 3D18_A, 3DTX_A, 3DX6_A, 3DX7_A, 3DX8_A, 3DXA_A, 3DXA_F, 3DXA_K, 3FFC_A, 3FFC_F, 3HCV_A, 3KPL_A, 3KPM_A, 3KPN_A, 3KPO_A, 3KPP_A, 3KPQ_A, 3KPR_A, 3KPR_F, 3KPS_A, 3KWW_A, 3KXF_A, 3KXF_C, 3KXF_I, 3KXF_K, 3L3D_A, 3L3G_A, 3L3I_A, 3L3J_A, 3L3K_A, 3LKN_A, 3LKO_A, 3LKP_A, 3LKQ_A, 3LKR_A, 3LKS_A, 3LN4_A, 3LN5_A, 3LV3_A, 3MV7_A, 3MV8_A, 3MV9_A, 3SJV_A, 3SJV_F, 3SJV_K, 3SJV_P, 3SKM_A, 3SKO_A, 3SPV_A, 3UPR_A, 3UPR_C, 3VCL_A, 3VFS_A, 3VFT_A, 3VFU_A, 3VFV_A, 3VFW_A, 3VH8_A, 3VH8_D, 3VRI_A, 3VRJ_A, 3W39_A, 3W39_D, 3WUW_A, 3X11_A, 3X12_A, 3X13_A, 3X14_A, 4G8G_A, 4G8I_A, 4G9D_A, 4G9F_A, 4JQV_A, 4JQX_A, 4LCY_A, 4LCY_F, 4LNR_A, 4MJI_A, 4MJI_F, 4O2C_A, 4O2E_A, 4O2E_D, 4O2F_A, 4O2F_D, 4PR5_A, 4PRN_A, 4QRP_A, 4QRP_F, 4QRQ_A, 4QRR_A, 4QRS_A, 4QRT_A, 4QRU_A, 4U1H_A, 4U1I_A, 4U1J_A, 4U1K_A, 4U1K_D, 4U1L_A, 4U1L_D, 4U1M_A, 4U1N_A, 4U1S_A, 4XXC_A, 5B38_A, 5B39_A, 5DEF_A, 5DEG_A, 5EO0_A, 5EO1_A, 5IB1_A, 5IB2_A, 5IB3_A, 5IB4_A, 5IB5_A, 5IB5_D, 5IEH_A, 5IEK_A, 5IM7_A, 5IM7_C, 5INC_A, 5INC_C, 5IND_A, 5IND_C, 5T6W_A, 5T6X_A, 5T6Y_A, 5T6Z_A, 5T70_A, 5TXS_A, 5U98_A, 5U98_D, 5V5L_A, 5V5L_C, 5V5M_A, 5V5M_C, 5VUD_A, 5VUE_A, 5VUF_A, 5VWD_A, 5VWF_A, 5VWH_A, 5VWJ_A, 5VZ5_A, 5WMN_A, 5WMN_C, 5WMO_A, 5WMP_A, 5WMQ_A, 5WMR_A, 5XOS_A, 5XOT_A, 6AT5_A, 6AVF_H, 6AVG_F, 6AVG_G, 6BJ2_A, 6BJ3_A, 6BJ8_A, 6BXP_A, 6BXQ_B, 6D29_A, 6D2B_A, 6D2R_A, 6D2T_A, 6MT3_A, 6MT4_A, 6MT5_A, 6MT6_A, 6MTL_A, 6MTM_A, 6P23_A, 6P27_A, 6P2C_A, 6P2F_A, 6P2S_A, 6PYJ_A, 6PYL_A, 6PYV_A, 6PYW_A, 6PZ5_A, 6UJ7_A, 6UJ7_D, 6UJ8_A, 6UJ8_D, 6UJ9_A, 6VMX_A, 6VMX_F, 7LFZ_A, 7LG0_A, 7LGD_A, 7LGD_C, 7LGT_A, 7LGT_C; xrefs (non-sequence databases): CCDS:CCDS34394.1, PDBsum:1A1M, PDBsum:1A1N, PDBsum:1A1O, PDBsum:1A9B, PDBsum:1A9E, PDBsum:1AGB, PDBsum:1AGC, PDBsum:1AGD, PDBsum:1AGE, PDBsum:1AGF, PDBsum:1CG9, PDBsum:1E27, PDBsum:1E28, PDBsum:1HSA, PDBsum:1JGD, PDBsum:1JGE, PDBsum:1K5N, PDBsum:1M05, PDBsum:1M6O, PDBsum:1MI5, PDBsum:1N2R, PDBsum:1OF2, PDBsum:1OGT, PDBsum:1SYS, PDBsum:1SYV, PDBsum:1UXS, PDBsum:1UXW, PDBsum:1W0V, PDBsum:1W0W, PDBsum:1XH3, PDBsum:1XR8, PDBsum:1XR9, PDBsum:1ZHK, PDBsum:1ZHL, PDBsum:1ZSD, PDBsum:2A83, PDBsum:2AK4, PDBsum:2AXF, PDBsum:2AXG, PDBsum:2BSR, PDBsum:2BSS, PDBsum:2BST, PDBsum:2BVO, PDBsum:2BVP, PDBsum:2BVQ, PDBsum:2H6P, PDBsum:2HJL, PDBsum:2NW3, PDBsum:2NX5, PDBsum:2RFX, PDBsum:2YPK, PDBsum:2YPL, PDBsum:3B3I, PDBsum:3B6S, PDBsum:3BP4, PDBsum:3BP7, PDBsum:3BW9, PDBsum:3BWA, PDBsum:3C9N, PDBsum:3CZF, PDBsum:3D18, PDBsum:3DTX, PDBsum:3DX6, PDBsum:3DX7, PDBsum:3DX8, PDBsum:3DXA, PDBsum:3FFC, PDBsum:3HCV, PDBsum:3KPL, PDBsum:3KPM, PDBsum:3KPN, PDBsum:3KPO, PDBsum:3KPP, PDBsum:3KPQ, PDBsum:3KPR, PDBsum:3KPS, PDBsum:3KWW, PDBsum:3KXF, PDBsum:3L3D, PDBsum:3L3G, PDBsum:3L3I, PDBsum:3L3J, PDBsum:3L3K, PDBsum:3LKN, PDBsum:3LKO, PDBsum:3LKP, PDBsum:3LKQ, PDBsum:3LKR, PDBsum:3LKS, PDBsum:3LN4, PDBsum:3LN5, PDBsum:3LV3, PDBsum:3MV7, PDBsum:3MV8, PDBsum:3MV9, PDBsum:3SJV, PDBsum:3SKM, PDBsum:3SKO, PDBsum:3SPV, PDBsum:3UPR, PDBsum:3VCL, PDBsum:3VFS, PDBsum:3VFT, PDBsum:3VFU, PDBsum:3VFV, PDBsum:3VFW, PDBsum:3VH8, PDBsum:3VRI, PDBsum:3VRJ, PDBsum:3W39, PDBsum:3WUW, PDBsum:3X11, PDBsum:3X12, PDBsum:3X13, PDBsum:3X14, PDBsum:4G8G, PDBsum:4G8I, PDBsum:4G9D, PDBsum:4G9F, PDBsum:4JQV, PDBsum:4JQX, PDBsum:4LCY, PDBsum:4LNR, PDBsum:4MJI, PDBsum:4O2C, PDBsum:4O2E, PDBsum:4O2F, PDBsum:4PR5, PDBsum:4PRN, PDBsum:4QRP, PDBsum:4QRQ, PDBsum:4QRR, PDBsum:4QRS, PDBsum:4QRT, PDBsum:4QRU, PDBsum:4U1H, PDBsum:4U1I, PDBsum:4U1J, PDBsum:4U1K, PDBsum:4U1L, PDBsum:4U1M, PDBsum:4U1N, PDBsum:4U1S, PDBsum:4XXC, PDBsum:5B38, PDBsum:5B39, PDBsum:5DEF, PDBsum:5DEG, PDBsum:5EO0, PDBsum:5EO1, PDBsum:5IB1, PDBsum:5IB2, PDBsum:5IB3, PDBsum:5IB4, PDBsum:5IB5, PDBsum:5IEH, PDBsum:5IEK, PDBsum:5IM7, PDBsum:5INC, PDBsum:5IND, PDBsum:5T6W, PDBsum:5T6X, PDBsum:5T6Y, PDBsum:5T6Z, PDBsum:5T70, PDBsum:5TXS, PDBsum:5U98, PDBsum:5V5L, PDBsum:5V5M, PDBsum:5VUD, PDBsum:5VUE, PDBsum:5VUF, PDBsum:5VWD, PDBsum:5VWF, PDBsum:5VWH, PDBsum:5VWJ, PDBsum:5VZ5, PDBsum:5WMN, PDBsum:5WMO, PDBsum:5WMP, PDBsum:5WMQ, PDBsum:5WMR, PDBsum:5XOS, PDBsum:5XOT, PDBsum:6AT5, PDBsum:6AVF, PDBsum:6AVG, PDBsum:6BJ2, PDBsum:6BJ3, PDBsum:6BJ8, PDBsum:6BXP, PDBsum:6BXQ, PDBsum:6D29, PDBsum:6D2B, PDBsum:6D2R, PDBsum:6D2T, PDBsum:6MT3, PDBsum:6MT4, PDBsum:6MT5, PDBsum:6MT6, PDBsum:6MTL, PDBsum:6MTM, PDBsum:6P23, PDBsum:6P27, PDBsum:6P2C, PDBsum:6P2F, PDBsum:6P2S, PDBsum:6PYJ, PDBsum:6PYL, PDBsum:6PYV, PDBsum:6PYW, PDBsum:6PZ5, PDBsum:6UJ7, PDBsum:6UJ8, PDBsum:6UJ9, PDBsum:6VMX, PDBsum:7LFZ, PDBsum:7LG0, PDBsum:7LGD, PDBsum:7LGT, AlphaFoldDB:P01889, SMR:P01889, BioGRID:109351, IntAct:P01889, MINT:P01889, STRING:9606.ENSP00000399168, DrugBank:DB01048, DrugBank:DB11294, DrugBank:DB04464, GlyConnect:1331, GlyConnect:1332, GlyConnect:1333, GlyConnect:1334, GlyConnect:1335, GlyConnect:1336, GlyConnect:1337, GlyConnect:1338, GlyConnect:1339, GlyConnect:1340, GlyConnect:1341, GlyConnect:1342, GlyConnect:1343, GlyConnect:1344, GlyConnect:1345, GlyConnect:1346, GlyConnect:1347, GlyConnect:1348, GlyConnect:1349, GlyConnect:1350, GlyConnect:1351, GlyGen:P01889, iPTMnet:P01889, PhosphoSitePlus:P01889, SwissPalm:P01889, BioMuta:HLA-B, DMDM:122160, EPD:P01889, jPOST:P01889, MassIVE:P01889, MaxQB:P01889, PaxDb:P01889, PeptideAtlas:P01889, PRIDE:P01889, ProteomicsDB:51504, ProteomicsDB:51628, ProteomicsDB:52598, ProteomicsDB:53565, ProteomicsDB:53566, ProteomicsDB:53567, ProteomicsDB:54677, ProteomicsDB:54678, ProteomicsDB:54679, ProteomicsDB:54680, ProteomicsDB:54681, ProteomicsDB:54682, ProteomicsDB:54683, ProteomicsDB:54684, ProteomicsDB:54685, ProteomicsDB:54686, ProteomicsDB:54687, ProteomicsDB:54688, ProteomicsDB:54689, ProteomicsDB:54690, ProteomicsDB:54691, ProteomicsDB:54692, ProteomicsDB:54693, ProteomicsDB:54694, ProteomicsDB:54695, ProteomicsDB:54696, ProteomicsDB:54697, ProteomicsDB:54732, ProteomicsDB:58284, ProteomicsDB:61272, ProteomicsDB:61273, ProteomicsDB:61276, ProteomicsDB:61584, ProteomicsDB:61586, ProteomicsDB:75730, Antibodypedia:26900, CPTC:P01889, DNASU:3106, Ensembl:ENST00000412585.7, Ensembl:ENSP00000399168.2, Ensembl:ENSG00000234745.14, Ensembl:ENST00000696559.1, Ensembl:ENSP00000512717.1, Ensembl:ENST00000696560.1, Ensembl:ENSP00000512718.1, Ensembl:ENST00000696561.1, Ensembl:ENSP00000512719.1, Ensembl:ENST00000696562.1, Ensembl:ENSP00000512720.1, GeneID:3106, KEGG:hsa:3106, MANE-Select:ENST00000412585.7, UCSC:uc011fcq.2, UCSC:uc011hpp.3, UCSC:uc011jij.3, CTD:3106, DisGeNET:3106, GeneCards:HLA-B, HGNC:4932, HPA:ENSG00000234745, MalaCards:HLA-B, MIM:106300, MIM:608579, neXtProt:NX_P01889, OpenTargets:ENSG00000234745, Orphanet:117, Orphanet:397, Orphanet:825, Orphanet:240841, Orphanet:240845, Orphanet:240871, Orphanet:414750, Orphanet:275798, Orphanet:29207, Orphanet:36426, Orphanet:3287, PharmGKB:PA35056, VEuPathDB:HostDB:ENSG00000234745, eggNOG:ENOG502RQEK, GeneTree:ENSGT00980000198488, HOGENOM:CLU_047501_1_1_1, OMA:ETERWIT, OrthoDB:651627at2759, PhylomeDB:P01889, TreeFam:TF336617, PathwayCommons:P01889, Reactome:R-HSA-1236974, Reactome:R-HSA-1236977, Reactome:R-HSA-198933, Reactome:R-HSA-2172127, Reactome:R-HSA-6798695, Reactome:R-HSA-877300, Reactome:R-HSA-909733, Reactome:R-HSA-9705671, Reactome:R-HSA-983170, SignaLink:P01889, SIGNOR:P01889, BioGRID-ORCS:3106, ChiTaRS:HLA-B, GeneWiki:HLA-B, GenomeRNAi:3106, Pharos:P01889, Proteomes:UP000005640, Bgee:ENSG00000234745, ExpressionAtlas:P01889, GO:0009986, GO:0031901, GO:0005783, GO:0012507, GO:0070062, GO:0005794, GO:0000139, GO:0071556, GO:0005887, GO:0016020, GO:0042612, GO:0030670, GO:0005886, GO:0055038, GO:0030667, GO:0051087, GO:0042605, GO:0005102, GO:0046977, GO:0002250, GO:0002486, GO:0006952, GO:0016045, GO:0006955, GO:0045087, GO:0001916, GO:0042270, GO:2001198, GO:0032655, GO:0032675, GO:0002667, Gene3D:2.60.40.10, Gene3D:3.30.500.10, InterPro:IPR007110, InterPro:IPR036179, InterPro:IPR013783, InterPro:IPR003006, InterPro:IPR003597, InterPro:IPR011161, InterPro:IPR037055, InterPro:IPR011162, InterPro:IPR001039, InterPro:IPR010579, Pfam:PF07654, Pfam:PF00129, Pfam:PF06623, PRINTS:PR01638, SMART:SM00407, SUPFAM:SSF48726, SUPFAM:SSF54452
Sequence mlvmaprtvllllsaalaltetwagshsmryfytsvsrpgrgeprfisvgyvddtqfvrfdsdaaspreeprapwieqegpeywdrntqiykaqaqtdreslrnlrgyynqseagshtlqsmygcdvgpdgrllrghdqyaydgkdyialnedlrswtaadtaaqitqrkweaareaeqrraylegecvewlrrylengkdkleradppkthvthhpisdheatlrcwalgfypaeitltwqrdgedqtqdtelvetrpagdrtfqkwaavvvpsgeeqrytchvqheglpkpltlrwepssqstvpivgivaglavlavvvigavvaavmcrrkssggkggsysqaacsdsaqgsdvslta