Yersinia pseudotuberculosis 633 Yersiniosis Yersinia pseudotuberculosis is a Gram-negative bacterium which primarily causes disease in animals; humans occasionally get infected zoonotically, most often through the food-borne route. In animals, Y. pseudotuberculosis can cause tuberculosis-like symptoms, including localized tissue necrosis and granulomas in the spleen, liver, and lymph node. In humans, symptoms are similar to those of infection with Yersinia enterocolitica (fever and right-sided abdominal pain), except that the diarrheal component is often absent, which sometimes makes the resulting condition difficult to diagnose. Y. pseudotuberculosis infections can mimic appendicitis, especially in children and younger adults, and, in rare cases the disease may cause skin complaints (erythema nodosum), joint stiffness and pain (reactive arthritis), or spread of bacteria to the blood (bacteremia) (Wiki: Y. pseudotuberuclosis). Baboon Papio cynocephalus 9556 Bank vole Clethrionomys glareolus 447135 Bear Ursus americanus 9643 Birds Passeroidea 175121 Brown Trout Salmo trutta 8032 Buffalo Bison bison 9901 Carnivores Vulpes 9625 Cat Felis catus 9685 Catfishes Siluriformes 7995 Cattle Bos taurus 9913 Chicken Gallus gallus 9031 Chimpanzee Pan troglodytes 9598 chinchillas Chinchillidae 10150 Copper Pheasant Syrmaticus soemmerringii 9067 Deer Cervus elaphus 9860 Deer mouse Peromyscus maniculatus 10042 Dog Canis familiaris 9615 Ducks Anas 8835 Ferret Mustela putorius furo 9669 Fish Hyperotreti 117565 Gerbil Gerbillina 10045 Goat Capra hircus 9925 Gray wolf Canis lupus 9612 Guinea pig Cavia porcellus 10141 Hamster Mesocricetus auratus 10036 Horse Equus caballus 9796 Human Homo sapiens 9606 Macaque Macaca fascicularis 9541 Mongolian Gerbil Meriones unguiculatus 10047 Monkey Platyrrhini 9479 Mouse Mus musculus 10090 None None Parrot Psittacidae 9224 Pig Sus scrofa 9823 Rabbit Oryctolagus cuniculus 9986 Rainbow trout Oncorhynchus mykiss 8022 Rat Rattus 10114 Raven Corvus corax 56781 sei whale Balaenoptera borealis 9768 Sheep Ovis aries 9940 Squirrel Spermophilus richardsonii 37591 Tree shrew Tupaiidae 9393 Trouts, salmons & chars Salmoninae 504568 Turkey Meleagris gallopavo 9103 Vole Microtus ochrogaster 79684 Water buffalo Bubalus bubalis 391902 licensed Yersiniosis human vaccine Generic Unknown VO_0002510 Inactivated or "killed" vaccine Licensed A generic representation of vaccines utilized to prevent Yersiniosis in humans, typically consisting of inactivated Yersinia bacteria to stimulate protective immunity without causing disease. These vaccines have historically been the most prevalent licensed type for human use against Yersiniosis. Yersinia pseudotuberculosis phoP mutant vaccine VO_0002947 Live, attenuated vaccine Research Oral immunization Oral immunization Gene mutation This phoP mutant is from Yersinia pseudotuberculosis IP 32953 (Balada-Llasat et al., 2007). A phoP mutant is attenuated in mice (Balada-Llasat et al., 2007). A phoP mutant provided protection against oral challenge with wild type Yersinia pseudotuberculosis (Balada-Llasat et al., 2007). phoP Yersinia pseudotuberculosis IP 32953 2956268 51596756 YPTB2434 BX936398 YP_070947 273123 2877188 2877859 + DNA-binding transcriptional regulator PhoP 5.6 23966.83 223 response regulator in two-component regulatory system with PhoQ; involved in magnesium starvation and stress >gi|51594359:2877188-2877859 Yersinia pseudotuberculosis IP 32953, complete genome TATGCGGGTTCTGGTTGTGGAAGATAACGCGTTGTTGCGTCACCATCTGACAGTGCAAATGCGTGAAATG GGCCATCAGGTTGATGCCGCGGAAGATGCTAAAGAAGCAGACTATTTCTTACAAGAGCATGCCCCCGACA TTGCTATTATCGATCTTGGTTTGCCCGGTGAAGACGGGTTAAGCCTTATCCGTCGCTGGCGTAGCCATCA AGAAAACTTACCCATTTTGGTCCTGACCGCACGGGAAAGCTGGCAAGATAAAGTCGCTGTACTGGAAGCC GGTGCCGACGATTATGTGACCAAACCGTTCCATCTGGAAGAGGTCATTGCCCGGATGCAAGCACTGATGC GGCGGAATATTGGCCTGGCCTCCCAAATTATTGAGCTACCGCCCTTCCAGATTGACCTTTCACGCCGTGA GTTATGTGTTAACCAACAACAAATTAAACTGACGGCATTTGAATACACTATCATTGAAACCCTTATCCGC AACGCAGGGAAAGTCGTTAGTAAGGATACGTTGATGCTACAACTTTATCCGGATGCGGAATTGCGAGAGA GCCATACTATCGATGTATTAATGGGTCGACTACGTAAAAAACTGCTGGCAGAACATCAGGGTGAAGTCAT TACGACTATTCGTGGTCAGGGATATCGTTTTGACGTCAACTA >gi|51596756|ref|YP_070947.1| DNA-binding transcriptional regulator PhoP [Yersinia pseudotuberculosis IP 32953] MRVLVVEDNALLRHHLTVQMREMGHQVDAAEDAKEADYFLQEHAPDIAIIDLGLPGEDGLSLIRRWRSHQ ENLPILVLTARESWQDKVAVLEAGADDYVTKPFHLEEVIARMQALMRRNIGLASQIIELPPFQIDLSRRE LCVNQQQIKLTAFEYTIIETLIRNAGKVVSKDTLMLQLYPDAELRESHTIDVLMGRLRKKLLAEHQGEVI TTIRGQGYRFDVN Virmugen A phoP mutant in Yersinia pseudotuberculosis (Yptb) was attenuated and provided protection against oral challenge with virulent Yptb in mice [Ref2064:Balada-Llasat et al., 2007]. Balada-Llasat et al., 2007 journal Balada-Llasat JM, Panilaitis B, Kaplan D, Mecsas J 2007 25 8 1526-1533 Vaccine Branger et al., 2009 journal Branger CG, Torres-Escobar A, Sun W, Perry R, Fetherston J, Roland KL, Curtiss R 3rd 2009 27 39 5363-5370 Vaccine Daniel et al., 2009 journal Daniel C, Sebbane F, Poiret S, Goudercourt D, Dewulf J, Mullet C, Simonet M, Pot B 2009 27 8 1141-1144 Vaccine Ivanov et al., 2008 journal Ivanov MI, Noel BL, Rampersaud R, Mena P, Benach JL, Bliska JB 2008 76 11 5181-5190 Infection and immunity Najdenski et al., 2009 journal Najdenski H, Golkocheva-Markova E, Kussovski V, Vesselinova A, Garbom S, Wolf-Watz H 2009 56 4 157-168 Zoonoses and public health Tsybul'skiĭ et al., 2011 journal Tsybul'skiĭ AV, Popov AM, Sanina NM, Mazeĭka AN, Portniagina OIu, Novikova OD, Timchenko NF, Kostetskiĭ ÉIa 2011 2 43-47 Zhurnal mikrobiologii, epidemiologii, i immunobiologii Wiki: Y. pseudotuberuclosis website http://en.wikipedia.org/wiki/Yersinia_pseudotuberculosis Zhang and Bliska, 2010 journal Zhang Y, Bliska JB 2010 78 5 2329-2341 Infection and immunity Zhang et al., 2012 journal Zhang Y, Mena P, Romanov G, Lin JS, Smiley ST, Bliska JB 2012 80 1 206-214 Infection and immunity