• Vaccine Ontology ID: VO_0011409
• Type: Subunit vaccine
• Status: Research
• Antigen: Hendra virus G glycoprotein
• G glycoprotein gene engineering:
  • Type: Recombinant protein preparation
  • Description: CpG oligodeoxynucleotide (ODN) 2007 (TCGTCGTTGTCGTTTTGTCGTT) containing a fully phosphorothioate backbone was purchased from Coley Pharmaceutical Group (Wellesley, MA, USA) and Allhydrogel™ was purchased from Accurate Chemical & Scientific Corporation (Westbury, NY, USA). Vaccine doses containing fixed amount of ODN 2007, varying amounts of sGHeV and aluminum ion (at a weight ratio of 1:25) were formulated as follows: 50 μg dose: 50 μg sGHeV, 1.25 mg aluminum ion and 150 μg of ODN 2007; 25 μg dose: 25 μg sGHeV, 625 μg aluminum ion and 150 μg of ODN 2007; and 5 μg dose: 5 μg sGHeV, 125 μg aluminum ion and 150 μg of ODN 2007. For all doses, Allhydrogel™ and sGHeV were mixed first before ODN 2007 was added. Each vaccine dose was adjusted to 1 ml with PBS and mixtures were incubated on a rotating wheel at room temperature for at least 2–3 h prior to injection (McEachern et al., 2008).
  • Detailed Gene Information: Click Here.
• Adjuvant:
  • VO ID: VO_0001237
• Immunization Route: Intramuscular injection (i.m.)

Cat Response

• Vaccination Protocol: Eight adult cats were immunised intramuscularly with vaccine preparations on day 0 and on day 21. Each cat received the same 1 ml dose for both prime and boost injections. All vaccine doses were given via intramuscular injection. Two animals received 50 μg doses (cat 29-50 and cat 30-50), two animals received 25 μg doses (cat 31-25 and cat 32-25), two animals received 5 μg doses (cat 33-5 and cat 34-5) and two animals received adjuvant-alone (cat 27-0 and cat 28-0). Each dose group contained one male and one female cat (McEachern et al., 2008).
• Challenge Protocol: On day 42, all animals were inoculated oronasally with 50,000 TCID50 of a low passage NiV isolate (EUKK 19817; stock virus titre 4.3 × 106 TCID50/ml) prepared as described previously [29]. Cats were assessed daily and scored out of 10 for a range of clinical observations, including alertness, grooming behavior, curiosity, depression, food consumption, faeces production and respiration rate (McEachern et al., 2008).
• Efficacy: A subunit vaccine formulation containing only recombinant, soluble, attachment glycoprotein G from HeV (sG(HeV)) and CpG adjuvant was evaluated as a potential NiV vaccine in the cat model. Upon oronasal challenge with NiV (50,000TCID50), all vaccinated cats were protected from disease although virus was detected on day 21 post-challenge in one animal (McEachern et al., 2008).