|
|
CpG DNA Vaccine Adjuvant |
|
Vaxjo ID |
10 |
|
Vaccine Adjuvant Name |
CpG DNA Vaccine Adjuvant |
|
Adjuvant VO ID |
VO_0001237
|
|
Description |
A new class of adjuvant is CpG DNA, which contains unmethylated CpG dinucleotides in particular base contexts (CpG motifs). CpG DNA is most often given in the form of synthetic oligodeoxynucleotides (CpG ODN) that are made with a nuclease-resistant phosphorothioate backbone (McCluskie and Davis, 1999). |
|
Stage of Development |
Clinical Trial |
|
Components |
DNA motifs consisting of an unmethylated CpG dinucleotide flanked by two 5′ purines (optimally GpA) and two 3′ pyrimidines (optimally TpC or TpT) stimulate an innate immune response characterized by the production of IgM, IFNγ, IL-6, IL-12, IL-18 and TNFα (Klinman et al., 1999). |
|
Preparation |
CpG ODN 1826 of sequence TCCATGACGTTCCTGACGTT (CpG) is synthesized with a nuclease-resistant phosphorothioate backbone by Hybridon (Milford, MA). This sequence was selected since of the thousands tested, it has the strongest immunostimulatory effects on mouse immune cells in vitro. Furthermore, it has previously been shown to be a potent adjuvant for antigen-specific responses in mice with both parenteral and mucosal immunizations. The ODN is to be resuspended in 10 mM Tris (pH 7.0), 1 mM EDTA for storage at +4°C before dilution into saline for immunization (McCluskie and Davis, 1999). |
|
Dosage |
A typical dose of CpG ODN used in these mouse vaccine studies is 10 to 50 µg (Hackett et al., 2006). |
|
Function |
CpG DNA has many effects that contribute to its adjuvant activity, including stimulation of B cells to proliferate, secrete immunoglobulin (Ig), IL-6 and IL-12, and to be protected from apoptosis. In addition, it enhances expression of class II MHC and B7 costimulatory molecules, that leads to improved antigen presentation. Furthermore, CpG DNA also directly activates monocytes, macrophages and dendritic cells to secrete various cytokines and chemokines that can provide T-helper functions. Immunization of animals against a variety of antigens delivered parenterally (e.g. IM or SC) demonstrate that addition of CpG ODN induces more T-helper type 1 (Th1)-like responses as indicated by strong cytotoxic T lymphocytes (CTL), high levels of IgG2a antibodies, and predominantly Th1 cytokines (e.g. IL-12 and IFN-γ but not IL-4 or IL-5). More recently, others and we have also shown CpG ODN to be a potent adjuvant to antigens delivered by intranasal (IN) inhalation (McCluskie and Davis, 1999). |
| Related Vaccine(s) |
|
| References |
(Hackett et al., 2006): Hackett, C.J., Harn D.A.. CpG ODN as a Th1 Immune Enhancer for Prophylactic and Therapeutic Vaccines. VACCINE ADJUVANTS: Immunological and Clinical Principles. 2006; ; 90-92.
Bode et al., 2011: Bode C, Zhao G, Steinhagen F, Kinjo T, Klinman DM. CpG DNA as a vaccine adjuvant. Expert review of vaccines. 2011; 10(4); 499-511. [PubMed: 21506647].
Klinman et al., 1999: Klinman DM, Barnhart KM, Conover J. CpG motifs as immune adjuvants. Vaccine. 1999; 17(1); 19-25. [PubMed: 10078603].
McCluskie and Davis, 1999: McCluskie MJ, Davis HL. CpG DNA as mucosal adjuvant. Vaccine. 1999; 18(3-4); 231-237. [PubMed: 10506647].
McCluskie et al., 2000: McCluskie MJ, Weeratna RD, Krieg AM, Davis HL. CpG DNA is an effective oral adjuvant to protein antigens in mice. Vaccine. 2000; 19(7-8); 950-957. [PubMed: 11115721].
|
|
